CNNM1 Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
 CNNM1 Polyclonal Antibody |
|
ES10745-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CNNM1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
|
CNNM1 Polyclonal Antibody |
|
ABP58208-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human CNNM1 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CNNM1 from Human, Mouse. This CNNM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CNNM1 protein |
|
CNNM1 Polyclonal Antibody |
|
ABP58208-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human CNNM1 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CNNM1 from Human, Mouse. This CNNM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CNNM1 protein |
|
CNNM1 Polyclonal Antibody |
|
ABP58208-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human CNNM1 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CNNM1 from Human, Mouse. This CNNM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CNNM1 protein |
|
CNNM1 Polyclonal Antibody |
|
A67602 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: fast delivery possible |
 CNNM1 Antibody |
|
44845-100ul |
SAB |
100ul |
EUR 252 |
|
CNNM1 Antibody |
|
44845-50ul |
SAB |
50ul |
EUR 187 |
|
CNNM1 Antibody |
|
1-CSB-PA878873LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against CNNM1. Recognizes CNNM1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200 |
|
CNNM1 Antibody |
|
DF2571 |
Affbiotech |
200ul |
EUR 304 |
|
Description: CNNM1 antibody detects endogenous levels of total CNNM1. |
 CNNM1 Polyclonal Antibody, HRP Conjugated |
|
A67603 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: reagents widely cited |
 CNNM1 Polyclonal Antibody, FITC Conjugated |
|
A67604 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: Ask the seller for details |
 CNNM1 Polyclonal Antibody, Biotin Conjugated |
|
A67605 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 CNNM1 Conjugated Antibody |
|
C44845 |
SAB |
100ul |
EUR 397 |
 Anti-CNNM1 antibody |
|
STJ191903 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to CNNM1 |
 CNNM1 siRNA |
|
20-abx912261 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
|
CNNM1 siRNA |
|
20-abx912262 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 CNNM1 Antibody, HRP conjugated |
|
1-CSB-PA878873LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against CNNM1. Recognizes CNNM1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 CNNM1 Antibody, FITC conjugated |
|
1-CSB-PA878873LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against CNNM1. Recognizes CNNM1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 CNNM1 Antibody, Biotin conjugated |
|
1-CSB-PA878873LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against CNNM1. Recognizes CNNM1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 Human Metal transporter CNNM1, CNNM1 ELISA KIT |
|
ELI-33259h |
Lifescience Market |
96 Tests |
EUR 824 |
 Mouse Metal transporter CNNM1, Cnnm1 ELISA KIT |
|
ELI-46825m |
Lifescience Market |
96 Tests |
EUR 865 |
 CNNM1 cloning plasmid |
|
CSB-CL878873HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1761
- Sequence: ATGGCAGCCGCCTTCCCCGTGTGCTACCCGCTGGGCCGCCTGCTGGACTGGGCGCTGCGCCAGGAGATAAGCACCTTCTACACGCGGGAGAAGTTGCTGGAGACGTTGCGGGCCGCAGACCCCTACAGTGACCTGGTGAAGGAGGAGCTCAACATCATACAGGGTGCCCTGGAGC
- Show more
|
|
Description: A cloning plasmid for the CNNM1 gene. |
 CNNM1 Blocking Peptide |
|
DF2571-BP |
Affbiotech |
1mg |
EUR 195 |
 Mouse CNNM1 shRNA Plasmid |
|
20-abx979149 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human CNNM1 shRNA Plasmid |
|
20-abx958837 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 (pORF)) Cnnm1 ORF Vector (Rat) (pORF) |
|
ORF065205 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Cnnm1 ORF Vector (Mouse) (pORF) |
|
ORF041673 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) CNNM1 ORF Vector (Human) (pORF) |
|
ORF012729 |
ABM |
1.0 ug DNA |
EUR 354 |
) CNNM1 sgRNA CRISPR Lentivector set (Human) |
|
K0476001 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Cnnm1 sgRNA CRISPR Lentivector set (Rat) |
|
K6151101 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Cnnm1 sgRNA CRISPR Lentivector set (Mouse) |
|
K3537001 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) CNNM1 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0476002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) CNNM1 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0476003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) CNNM1 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0476004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Cnnm1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6151102 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Cnnm1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6151103 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Cnnm1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6151104 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Cnnm1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3537002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Cnnm1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3537003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Cnnm1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3537004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) CNNM1 Protein Vector (Human) (pPB-C-His) |
|
PV050913 |
ABM |
500 ng |
EUR 481 |
 (pPB-N-His)) CNNM1 Protein Vector (Human) (pPB-N-His) |
|
PV050914 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-HA)) CNNM1 Protein Vector (Human) (pPM-C-HA) |
|
PV050915 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-His)) CNNM1 Protein Vector (Human) (pPM-C-His) |
|
PV050916 |
ABM |
500 ng |
EUR 481 |
 (pPB-C-His)) CNNM1 Protein Vector (Mouse) (pPB-C-His) |
|
PV166690 |
ABM |
500 ng |
EUR 1065 |
 (pPB-N-His)) CNNM1 Protein Vector (Mouse) (pPB-N-His) |
|
PV166691 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-HA)) CNNM1 Protein Vector (Mouse) (pPM-C-HA) |
|
PV166692 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-His)) CNNM1 Protein Vector (Mouse) (pPM-C-His) |
|
PV166693 |
ABM |
500 ng |
EUR 1065 |
 (pPB-C-His)) CNNM1 Protein Vector (Rat) (pPB-C-His) |
|
PV260818 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) CNNM1 Protein Vector (Rat) (pPB-N-His) |
|
PV260819 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) CNNM1 Protein Vector (Rat) (pPM-C-HA) |
|
PV260820 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) CNNM1 Protein Vector (Rat) (pPM-C-His) |
|
PV260821 |
ABM |
500 ng |
EUR 603 |
 Cnnm1 3'UTR Luciferase Stable Cell Line |
|
TU202550 |
ABM |
1.0 ml |
Ask for price |
 Cnnm1 3'UTR GFP Stable Cell Line |
|
TU154104 |
ABM |
1.0 ml |
Ask for price |
 CNNM1 3'UTR Luciferase Stable Cell Line |
|
TU004693 |
ABM |
1.0 ml |
EUR 1521 |
|
Cnnm1 3'UTR Luciferase Stable Cell Line |
|
TU104104 |
ABM |
1.0 ml |
Ask for price |
 CNNM1 3'UTR GFP Stable Cell Line |
|
TU054693 |
ABM |
1.0 ml |
EUR 1521 |
|
Cnnm1 3'UTR GFP Stable Cell Line |
|
TU252550 |
ABM |
1.0 ml |
Ask for price |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
|
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
|
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
|
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
|
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
|
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATG7 Rabbit Polyclonal Antibody |
|
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG13 Rabbit Polyclonal Antibody |
|
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATG13 Rabbit Polyclonal Antibody |
|
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG14L Rabbit Polyclonal Antibody |
|
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATG14L Rabbit Polyclonal Antibody |
|
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NBR1 Rabbit Polyclonal Antibody |
|
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
NBR1 Rabbit Polyclonal Antibody |
|
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Gab1 Rabbit Polyclonal Antibody |
|
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
Gab1 Rabbit Polyclonal Antibody |
|
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CNNM1 Rabbit Polyclonal Antibody
