CNNM3 Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
CNNM3 Polyclonal Antibody |
ABP58209-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human CNNM3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of CNNM3 from Human. This CNNM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CNNM3 protein |
CNNM3 Polyclonal Antibody |
ES10746-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CNNM3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
CNNM3 Polyclonal Antibody |
ES10746-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CNNM3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
CNNM3 Rabbit pAb |
A4625-100ul |
Abclonal |
100 ul |
EUR 308 |
CNNM3 Rabbit pAb |
A4625-200ul |
Abclonal |
200 ul |
EUR 459 |
CNNM3 Rabbit pAb |
A4625-20ul |
Abclonal |
20 ul |
EUR 183 |
CNNM3 Rabbit pAb |
A4625-50ul |
Abclonal |
50 ul |
EUR 223 |
Metal Transporter CNNM3 (CNNM3) Antibody |
20-abx003478 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Metal Transporter CNNM3 (CNNM3) Antibody |
20-abx210792 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Metal Transporter CNNM3 (CNNM3) Antibody |
20-abx211751 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Metal Transporter CNNM3 (CNNM3) Antibody |
20-abx111860 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Metal Transporter CNNM3 (CNNM3) Antibody |
abx031044-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Metal Transporter CNNM3 (CNNM3) Antibody |
abx031044-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Metal Transporter CNNM3 (CNNM3) Antibody |
20-abx334047 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Metal Transporter CNNM3 (CNNM3) Antibody |
abx231803-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
CNNM3 antibody |
70R-16477 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal CNNM3 antibody |
CNNM3 Antibody |
35704-100ul |
SAB |
100ul |
EUR 252 |
CNNM3 antibody |
10R-1705 |
Fitzgerald |
100 ug |
EUR 512 |
Description: Mouse monoclonal CNNM3 antibody |
CNNM3 Antibody |
1-CSB-PA843333LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CNNM3. Recognizes CNNM3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:200-1:500, IF:1:50-1:200 |
CNNM3 Antibody |
1-CSB-PA005660GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against CNNM3. Recognizes CNNM3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
CNNM3 Antibody |
DF2572 |
Affbiotech |
200ul |
EUR 304 |
Description: CNNM3 antibody detects endogenous levels of total CNNM3. |
CNNM3 Antibody |
1-CSB-PA254306 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CNNM3. Recognizes CNNM3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
CNNM3 Antibody |
1-CSB-PA161346 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CNNM3. Recognizes CNNM3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100 |
Metal Transporter CNNM3 (CNNM3) Antibody (HRP) |
20-abx336495 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Metal Transporter CNNM3 (CNNM3) Antibody (FITC) |
20-abx336496 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Metal Transporter CNNM3 (CNNM3) Antibody (Biotin) |
20-abx336497 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
CNNM3 Conjugated Antibody |
C35704 |
SAB |
100ul |
EUR 397 |
anti- CNNM3 antibody |
FNab01803 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: cyclin M3
- Uniprot ID: Q8NE01
- Gene ID: 26505
- Research Area: Signal Transduction, Metabolism
|
Description: Antibody raised against CNNM3 |
Anti-CNNM3 antibody |
STJ191904 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to CNNM3 |
CNNM3 siRNA |
20-abx912265 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CNNM3 siRNA |
20-abx912266 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CNNM3 Antibody, HRP conjugated |
1-CSB-PA843333LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CNNM3. Recognizes CNNM3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
CNNM3 Antibody, FITC conjugated |
1-CSB-PA843333LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CNNM3. Recognizes CNNM3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
CNNM3 Antibody, Biotin conjugated |
1-CSB-PA843333LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CNNM3. Recognizes CNNM3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Human Metal Transporter CNNM3 (CNNM3) ELISA Kit |
abx386601-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Metal transporter CNNM3, CNNM3 ELISA KIT |
ELI-31876h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse Metal transporter CNNM3, Cnnm3 ELISA KIT |
ELI-46826m |
Lifescience Market |
96 Tests |
EUR 865 |
CNNM3 Blocking Peptide |
DF2572-BP |
Affbiotech |
1mg |
EUR 195 |
CNNM3 cloning plasmid |
CSB-CL843333HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1068
- Sequence: atgctggacgccagcaccgtgctggacttcggcgtcctggccagcatcatgcagagcggccacacgcgcatcccggtgtacgaggaggagcgctccaacatcgtggacatgctctacctcaaggacttggccttcgtggatcccgaagactgcacgccgctcagcaccatcactc
- Show more
|
Description: A cloning plasmid for the CNNM3 gene. |
Human CNNM3 shRNA Plasmid |
20-abx958836 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse CNNM3 shRNA Plasmid |
20-abx979293 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CNNM3 Recombinant Protein (Human) |
RP007498 |
ABM |
100 ug |
Ask for price |
CNNM3 Recombinant Protein (Rat) |
RP195617 |
ABM |
100 ug |
Ask for price |
CNNM3 Recombinant Protein (Mouse) |
RP125024 |
ABM |
100 ug |
Ask for price |
CNNM3 Recombinant Protein (Mouse) |
RP125027 |
ABM |
100 ug |
Ask for price |
Cnnm3 ORF Vector (Rat) (pORF) |
ORF065207 |
ABM |
1.0 ug DNA |
EUR 506 |
CNNM3 ORF Vector (Human) (pORF) |
ORF002500 |
ABM |
1.0 ug DNA |
EUR 95 |
Cnnm3 ORF Vector (Mouse) (pORF) |
ORF041676 |
ABM |
1.0 ug DNA |
EUR 506 |
Cnnm3 ORF Vector (Mouse) (pORF) |
ORF041677 |
ABM |
1.0 ug DNA |
EUR 506 |
CNNM3 sgRNA CRISPR Lentivector set (Human) |
K0476201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cnnm3 sgRNA CRISPR Lentivector set (Rat) |
K6684801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cnnm3 sgRNA CRISPR Lentivector set (Mouse) |
K3456001 |
ABM |
3 x 1.0 ug |
EUR 339 |
CNNM3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0476202 |
ABM |
1.0 ug DNA |
EUR 154 |
CNNM3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0476203 |
ABM |
1.0 ug DNA |
EUR 154 |
CNNM3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0476204 |
ABM |
1.0 ug DNA |
EUR 154 |
Cnnm3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6684802 |
ABM |
1.0 ug DNA |
EUR 154 |
Cnnm3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6684803 |
ABM |
1.0 ug DNA |
EUR 154 |
Cnnm3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6684804 |
ABM |
1.0 ug DNA |
EUR 154 |
Cnnm3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3456002 |
ABM |
1.0 ug DNA |
EUR 154 |
Cnnm3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3456003 |
ABM |
1.0 ug DNA |
EUR 154 |
Cnnm3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3456004 |
ABM |
1.0 ug DNA |
EUR 154 |
CNNM3 Protein Vector (Mouse) (pPB-C-His) |
PV166702 |
ABM |
500 ng |
EUR 1065 |
CNNM3 Protein Vector (Mouse) (pPB-N-His) |
PV166703 |
ABM |
500 ng |
EUR 1065 |
CNNM3 Protein Vector (Mouse) (pPM-C-HA) |
PV166704 |
ABM |
500 ng |
EUR 1065 |
CNNM3 Protein Vector (Mouse) (pPM-C-His) |
PV166705 |
ABM |
500 ng |
EUR 1065 |
CNNM3 Protein Vector (Mouse) (pPB-C-His) |
PV166706 |
ABM |
500 ng |
EUR 1065 |
CNNM3 Protein Vector (Mouse) (pPB-N-His) |
PV166707 |
ABM |
500 ng |
EUR 1065 |
CNNM3 Protein Vector (Mouse) (pPM-C-HA) |
PV166708 |
ABM |
500 ng |
EUR 1065 |
CNNM3 Protein Vector (Mouse) (pPM-C-His) |
PV166709 |
ABM |
500 ng |
EUR 1065 |
CNNM3 Protein Vector (Rat) (pPB-C-His) |
PV260826 |
ABM |
500 ng |
EUR 1191 |
CNNM3 Protein Vector (Rat) (pPB-N-His) |
PV260827 |
ABM |
500 ng |
EUR 1191 |
CNNM3 Protein Vector (Rat) (pPM-C-HA) |
PV260828 |
ABM |
500 ng |
EUR 1191 |
CNNM3 Protein Vector (Rat) (pPM-C-His) |
PV260829 |
ABM |
500 ng |
EUR 1191 |
CNNM3 Protein Vector (Human) (pPB-C-His) |
PV009997 |
ABM |
500 ng |
EUR 329 |
CNNM3 Protein Vector (Human) (pPB-N-His) |
PV009998 |
ABM |
500 ng |
EUR 329 |
CNNM3 Protein Vector (Human) (pPM-C-HA) |
PV009999 |
ABM |
500 ng |
EUR 329 |
CNNM3 Protein Vector (Human) (pPM-C-His) |
PV010000 |
ABM |
500 ng |
EUR 329 |
Cnnm3 3'UTR GFP Stable Cell Line |
TU154106 |
ABM |
1.0 ml |
Ask for price |
Cnnm3 3'UTR Luciferase Stable Cell Line |
TU104106 |
ABM |
1.0 ml |
Ask for price |
Cnnm3 3'UTR Luciferase Stable Cell Line |
TU202552 |
ABM |
1.0 ml |
Ask for price |
Cnnm3 3'UTR GFP Stable Cell Line |
TU252552 |
ABM |
1.0 ml |
Ask for price |
CNNM3 3'UTR GFP Stable Cell Line |
TU054695 |
ABM |
1.0 ml |
EUR 1394 |
CNNM3 3'UTR Luciferase Stable Cell Line |
TU004695 |
ABM |
1.0 ml |
EUR 1394 |
CNNM3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV651445 |
ABM |
1.0 ug DNA |
EUR 1355 |
CNNM3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV651449 |
ABM |
1.0 ug DNA |
EUR 1355 |
CNNM3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV651450 |
ABM |
1.0 ug DNA |
EUR 1355 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
CNNM3 Rabbit Polyclonal Antibody