CUL5 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

CUL5 Polyclonal Antibody

ABP58300-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CUL5 protein at amino acid sequence of 560-640
  • Applications tips:
Description: A polyclonal antibody for detection of CUL5 from Human, Mouse, Rat. This CUL5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CUL5 protein at amino acid sequence of 560-640

CUL5 Polyclonal Antibody

ABP58300-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CUL5 protein at amino acid sequence of 560-640
  • Applications tips:
Description: A polyclonal antibody for detection of CUL5 from Human, Mouse, Rat. This CUL5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CUL5 protein at amino acid sequence of 560-640

CUL5 Rabbit pAb

A5369-100ul 100 ul
EUR 308

CUL5 Rabbit pAb

A5369-200ul 200 ul
EUR 459

CUL5 Rabbit pAb

A5369-20ul 20 ul
EUR 183

CUL5 Rabbit pAb

A5369-50ul 50 ul
EUR 223

CUL5 Antibody

ABD2323 100 ug
EUR 438

CUL5 Antibody

ABD7306 100 ug
EUR 438

CUL5 Antibody

32809-100ul 100ul
EUR 252

CUL5 Antibody

DF7306 200ul
EUR 304
Description: CUL5 Antibody detects endogenous levels of total CUL5.

CUL5 Antibody

DF2323 200ul
EUR 304
Description: CUL5 antibody detects endogenous levels of total CUL5.

CUL5 Antibody

1-CSB-PA835890ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CUL5. Recognizes CUL5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CUL5 Antibody

1-CSB-PA835890ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CUL5. Recognizes CUL5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CUL5 Antibody

1-CSB-PA113726
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CUL5. Recognizes CUL5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50

Polyclonal CUL5 Antibody (C-term)

APR05939G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CUL5 (C-term). This antibody is tested and proven to work in the following applications:

CUL5 Conjugated Antibody

C32809 100ul
EUR 397

Anti-CUL5 antibody

STJ27322 100 µl
EUR 277

Anti-CUL5 antibody

STJ191691 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CUL5

Cul5/ Rat Cul5 ELISA Kit

ELI-09944r 96 Tests
EUR 886

Polyclonal CUL5 / Cullin-5 Antibody (aa113-583)

APR03296G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CUL5 / Cullin-5 (aa113-583). This antibody is tested and proven to work in the following applications:

CUL5 siRNA

20-abx901341
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CUL5 siRNA

20-abx913198
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CUL5 siRNA

20-abx913199
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Rabbit Cullin 5(CUL5) ELISA kit

E04C2186-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cullin 5(CUL5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cullin 5(CUL5) ELISA kit

E04C2186-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cullin 5(CUL5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cullin 5(CUL5) ELISA kit

E04C2186-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cullin 5(CUL5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cullin- 5, CUL5 ELISA KIT

ELI-25947Ra 96 Tests
EUR 928

Cullin 5 (CUL5) Antibody

abx122600-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Cullin 5 (CUL5) Antibody

abx037823-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Cullin 5 (CUL5) Antibody

abx033487-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Cullin 5 (CUL5) Antibody

abx033487-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Cullin 5 (CUL5) Antibody

abx023911-01ml 0.1 ml
EUR 1052
  • Shipped within 5-10 working days.

Cullin 5 (CUL5) Antibody

20-abx004110
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cullin 5 (CUL5) Antibody

20-abx320142
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cullin 5 (CUL5) Antibody

20-abx320143
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cullin 5 (CUL5) Antibody

20-abx213650
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cullin 5 (CUL5) Antibody

20-abx225132
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

CUL5 Blocking Peptide

DF7306-BP 1mg
EUR 195

CUL5 Blocking Peptide

DF2323-BP 1mg
EUR 195

CUL5 cloning plasmid

CSB-CL835890HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2343
  • Sequence: atggcgacgtctaatctgttaaagaataaaggttctcttcagtttgaagacaaatgggattttatgcgcccgattgttttgaagcttttacgccaggaatctgttacaaaacagcagtggtttgatctgttttcggatgtgcatgcagtctgtctttgggatgataaaggcccag
  • Show more
Description: A cloning plasmid for the CUL5 gene.

Anti-Cul5/Cullin 5 Antibody

A01925 100uL
EUR 432
Description: Rabbit Polyclonal Cul5/Cullin 5 Antibody. Validated in IHC and tested in Human.

Anti-Cullin 5/CUL5 Antibody

A01925-1 100ug/vial
EUR 294

Mouse CUL5 shRNA Plasmid

20-abx978479
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat CUL5 shRNA Plasmid

20-abx986314
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CUL5 shRNA Plasmid

20-abx955355
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CUL5 ORF Vector (Human) (pORF)

ORF002799 1.0 ug DNA
EUR 95

Cul5 ORF Vector (Rat) (pORF)

ORF065610 1.0 ug DNA
EUR 506

Cul5 ORF Vector (Mouse) (pORF)

ORF042262 1.0 ug DNA
EUR 506

Cul5 ORF Vector (Mouse) (pORF)

ORF042263 1.0 ug DNA
EUR 506

CUL5 ELISA Kit (Human) (OKEH08245)

OKEH08245 96 Wells
EUR 896
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.176ng/mL

CUL5 ELISA Kit (Human) (OKWB00205)

OKWB00205 96 Wells
EUR 572
Description: Description of target: Core component of multiple SCF-like ECS (Elongin-Cullin 2/5-SOCS-box protein) E3 ubiquitin-protein ligase complexes, which mediate the ubiquitination and subsequent proteasomal degradation of target proteins. As a scaffold protein may contribute to catalysis through positioning of the substrate and the ubiquitin-conjugating enzyme. The functional specificity of the E3 ubiquitin-protein ligase complex depends on the variable substrate recognition component. ECS(SOCS1) seems to direct ubiquitination of JAK2. Seems to be involved in proteosomal degradation of p53/TP53 stimulated by adenovirus E1B-55 kDa protein. May form a cell surface vasopressin receptor. ;Species reactivity: Human;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL

Human Cullin 5 (CUL5) ELISA Kit

abx556370-96tests 96 tests
EUR 715
  • Shipped within 1-2 months.

Human Cullin 5 (CUL5) ELISA Kit

20-abx509251
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 1-2 months.

Goat Cullin 5(CUL5) ELISA kit

E06C2186-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Cullin 5(CUL5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cullin 5(CUL5) ELISA kit

E06C2186-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Cullin 5(CUL5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cullin 5(CUL5) ELISA kit

E06C2186-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Cullin 5(CUL5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CUL5/ Cullin-5 ELISA Kit

E0609Hu 1 Kit
EUR 605

Human Cullin 5(CUL5) ELISA kit

E01C2186-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cullin 5(CUL5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cullin 5(CUL5) ELISA kit

E01C2186-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cullin 5(CUL5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cullin 5(CUL5) ELISA kit

E01C2186-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cullin 5(CUL5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cullin 5(CUL5) ELISA kit

E02C2186-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Cullin 5(CUL5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cullin 5(CUL5) ELISA kit

E02C2186-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Cullin 5(CUL5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cullin 5(CUL5) ELISA kit

E02C2186-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Cullin 5(CUL5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cullin 5(CUL5) ELISA kit

E03C2186-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cullin 5(CUL5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cullin 5(CUL5) ELISA kit

E03C2186-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cullin 5(CUL5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cullin 5(CUL5) ELISA kit

E03C2186-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cullin 5(CUL5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cullin 5(CUL5) ELISA kit

E08C2186-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Cullin 5(CUL5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cullin 5(CUL5) ELISA kit

E08C2186-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Cullin 5(CUL5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cullin 5(CUL5) ELISA kit

E08C2186-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Cullin 5(CUL5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cullin 5(CUL5) ELISA kit

E09C2186-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cullin 5(CUL5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cullin 5(CUL5) ELISA kit

E09C2186-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cullin 5(CUL5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cullin 5(CUL5) ELISA kit

E09C2186-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cullin 5(CUL5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cullin 5(CUL5) ELISA kit

E07C2186-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Cullin 5(CUL5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cullin 5(CUL5) ELISA kit

E07C2186-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Cullin 5(CUL5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cullin 5(CUL5) ELISA kit

E07C2186-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Cullin 5(CUL5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cullin- 5, Cul5 ELISA KIT

ELI-25946m 96 Tests
EUR 865

Human Cullin- 5, CUL5 ELISA KIT

ELI-33584h 96 Tests
EUR 824

CUL5 sgRNA CRISPR Lentivector set (Human)

K0532701 3 x 1.0 ug
EUR 339

Human Cullin 5 (CUL5) ELISA Kit

abx257714-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Cul5 sgRNA CRISPR Lentivector set (Mouse)

K3673401 3 x 1.0 ug
EUR 339

Cul5 sgRNA CRISPR Lentivector set (Rat)

K6972401 3 x 1.0 ug
EUR 339

Human Cullin 5(CUL5)ELISA Kit

QY-E05013 96T
EUR 361

Guinea pig Cullin 5(CUL5) ELISA kit

E05C2186-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Cullin 5(CUL5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Cullin 5(CUL5) ELISA kit

E05C2186-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Cullin 5(CUL5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Cullin 5(CUL5) ELISA kit

E05C2186-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Cullin 5(CUL5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CUL5 sgRNA CRISPR Lentivector (Human) (Target 1)

K0532702 1.0 ug DNA
EUR 154

CUL5 sgRNA CRISPR Lentivector (Human) (Target 2)

K0532703 1.0 ug DNA
EUR 154

CUL5 sgRNA CRISPR Lentivector (Human) (Target 3)

K0532704 1.0 ug DNA
EUR 154

Cul5 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3673402 1.0 ug DNA
EUR 154

Cul5 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3673403 1.0 ug DNA
EUR 154

Cul5 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3673404 1.0 ug DNA
EUR 154

Cul5 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6972402 1.0 ug DNA
EUR 154

Cul5 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6972403 1.0 ug DNA
EUR 154

Cul5 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6972404 1.0 ug DNA
EUR 154

CUL5 Protein Vector (Human) (pPB-C-His)

PV011193 500 ng
EUR 329

CUL5 Protein Vector (Human) (pPB-N-His)

PV011194 500 ng
EUR 329

CUL5 Protein Vector (Human) (pPM-C-HA)

PV011195 500 ng
EUR 329

CUL5 Protein Vector (Human) (pPM-C-His)

PV011196 500 ng
EUR 329

CUL5 Protein Vector (Mouse) (pPB-C-His)

PV169046 500 ng
EUR 1065

CUL5 Protein Vector (Mouse) (pPB-N-His)

PV169047 500 ng
EUR 1065

CUL5 Protein Vector (Mouse) (pPM-C-HA)

PV169048 500 ng
EUR 1065

CUL5 Protein Vector (Mouse) (pPM-C-His)

PV169049 500 ng
EUR 1065

CUL5 Protein Vector (Mouse) (pPB-C-His)

PV169050 500 ng
EUR 1065

CUL5 Protein Vector (Mouse) (pPB-N-His)

PV169051 500 ng
EUR 1065

CUL5 Protein Vector (Mouse) (pPM-C-HA)

PV169052 500 ng
EUR 1065

CUL5 Protein Vector (Mouse) (pPM-C-His)

PV169053 500 ng
EUR 1065

CUL5 Protein Vector (Rat) (pPB-C-His)

PV262438 500 ng
EUR 1166

CUL5 Protein Vector (Rat) (pPB-N-His)

PV262439 500 ng
EUR 1166

CUL5 Protein Vector (Rat) (pPM-C-HA)

PV262440 500 ng
EUR 1166

CUL5 Protein Vector (Rat) (pPM-C-His)

PV262441 500 ng
EUR 1166

Cul5 3'UTR Luciferase Stable Cell Line

TU202969 1.0 ml Ask for price

Cul5 3'UTR GFP Stable Cell Line

TU154557 1.0 ml Ask for price

CUL5 3'UTR Luciferase Stable Cell Line

TU005281 1.0 ml
EUR 2333

Cul5 3'UTR Luciferase Stable Cell Line

TU104557 1.0 ml Ask for price

CUL5 3'UTR GFP Stable Cell Line

TU055281 1.0 ml
EUR 2333

Cul5 3'UTR GFP Stable Cell Line

TU252969 1.0 ml Ask for price

CUL5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV672097 1.0 ug DNA
EUR 1355

CUL5 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV672101 1.0 ug DNA
EUR 1355

CUL5 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV672102 1.0 ug DNA
EUR 1355

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

CUL5 Rabbit Polyclonal Antibody