CYB5B Rabbit Polyclonal Antibody

Order Now:

CYB5B Polyclonal Antibody
ES10680-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CYB5B from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
CYB5B Polyclonal Antibody
ABP58310-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human CYB5B protein at amino acid sequence of 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of CYB5B from Human. This CYB5B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CYB5B protein at amino acid sequence of 50-130
CYB5B Polyclonal Antibody
ABP58310-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CYB5B protein at amino acid sequence of 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of CYB5B from Human. This CYB5B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CYB5B protein at amino acid sequence of 50-130
CYB5B Polyclonal Antibody
ABP58310-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CYB5B protein at amino acid sequence of 50-130
  • Applications tips:
Description: A polyclonal antibody for detection of CYB5B from Human. This CYB5B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CYB5B protein at amino acid sequence of 50-130
CYB5B Polyclonal Antibody
A62362 100 µg
EUR 570.55
Description: The best epigenetics products
CYB5B Rabbit pAb
A15900-100ul 100 ul
EUR 308
CYB5B Rabbit pAb
A15900-200ul 200 ul
EUR 459
CYB5B Rabbit pAb
A15900-20ul 20 ul
EUR 183
CYB5B Rabbit pAb
A15900-50ul 50 ul
EUR 223
CYB5B Antibody
ABD2488 100 ug
EUR 438
CYB5B Antibody
44797-100ul 100ul
EUR 252
CYB5B Antibody
44797-50ul 50ul
EUR 187
CYB5B antibody
70R-16692 50 ul
EUR 435
Description: Rabbit polyclonal CYB5B antibody
CYB5B Antibody
DF2488 200ul
EUR 304
Description: CYB5B antibody detects endogenous levels of total CYB5B.
CYB5B Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CYB5B. Recognizes CYB5B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
CYB5B Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CYB5B. Recognizes CYB5B from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200
CYB5B Polyclonal Antibody, HRP Conjugated
A62363 100 µg
EUR 570.55
Description: kits suitable for this type of research
CYB5B Polyclonal Antibody, FITC Conjugated
A62364 100 µg
EUR 570.55
Description: fast delivery possible
CYB5B Polyclonal Antibody, Biotin Conjugated
A62365 100 µg
EUR 570.55
Description: reagents widely cited
CYB5B Conjugated Antibody
C44797 100ul
EUR 397
anti- CYB5B antibody
FNab02114 100µg
EUR 505.25
  • Immunogen: cytochrome b5 type B(outer mitochondrial membrane)
  • Uniprot ID: O43169
  • Gene ID: 80777
  • Research Area: Metabolism
Description: Antibody raised against CYB5B
Anti-CYB5B antibody
PAab02114 100 ug
EUR 355
Anti-CYB5B antibody
STJ118359 100 µl
EUR 277
Anti-CYB5B antibody
STJ191838 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CYB5B
Cyb5b/ Rat Cyb5b ELISA Kit
ELI-32376r 96 Tests
EUR 886
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CYB5B Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CYB5B. Recognizes CYB5B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
CYB5B Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CYB5B. Recognizes CYB5B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
CYB5B Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CYB5B. Recognizes CYB5B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
CYB5B cloning plasmid
CSB-CL006310HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 441
  • Sequence: atggcgactgcggaagctagcggcagcgatgggaaagggcaggaagtcgagacctcagtcacctattaccggttggaggaggtggcaaagcgcaactccttgaaggaactgtggcttgtgatccatgggcgagtctacgatgtcacccgcttcctcaacgagcaccctggaggaga
  • Show more
Description: A cloning plasmid for the CYB5B gene.
CYB5B Blocking Peptide
DF2488-BP 1mg
EUR 195
Rabbit Cytochrome b5 type B(CYB5B) ELISA kit
E04C2207-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cytochrome b5 type B(CYB5B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Cytochrome b5 type B(CYB5B) ELISA kit
E04C2207-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cytochrome b5 type B(CYB5B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Cytochrome b5 type B(CYB5B) ELISA kit
E04C2207-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cytochrome b5 type B(CYB5B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Cytochrome B5 Type B (CYB5B) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Cytochrome B5 Type B (CYB5B) Antibody
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Cytochrome B5 Type B (CYB5B) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Cytochrome B5 Type B (CYB5B) Antibody
abx232114-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Mouse CYB5B shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat CYB5B shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human CYB5B shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
EF008937 96 Tests
EUR 689
CYB5B Recombinant Protein (Human)
RP008536 100 ug Ask for price
CYB5B Recombinant Protein (Rat)
RP196961 100 ug Ask for price
CYB5B Recombinant Protein (Mouse)
RP126953 100 ug Ask for price
Cytochrome B5 Type B (CYB5B) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Cytochrome B5 Type B (CYB5B) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Cytochrome B5 Type B (CYB5B) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CYB5B Rabbit Polyclonal Antibody