E2F8 Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
E2F8 Polyclonal Antibody |
ABP58447-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human E2F8 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of E2F8 from Human. This E2F8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human E2F8 protein |
E2F8 Polyclonal Antibody |
ABP58447-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human E2F8 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of E2F8 from Human. This E2F8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human E2F8 protein |
E2F8 Polyclonal Antibody |
ES10764-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against E2F8 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
E2F8 Polyclonal Antibody |
ES10764-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against E2F8 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
E2F8 Rabbit pAb |
A1135-100ul |
Abclonal |
100 ul |
EUR 308 |
E2F8 Rabbit pAb |
A1135-200ul |
Abclonal |
200 ul |
EUR 459 |
E2F8 Rabbit pAb |
A1135-20ul |
Abclonal |
20 ul |
EUR 183 |
E2F8 Rabbit pAb |
A1135-50ul |
Abclonal |
50 ul |
EUR 223 |
E2F8 antibody |
70R-16978 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal E2F8 antibody |
E2F8 Antibody |
32173-100ul |
SAB |
100ul |
EUR 252 |
E2F8 Antibody |
43312-100ul |
SAB |
100ul |
EUR 252 |
E2F8 Antibody |
DF6269 |
Affbiotech |
200ul |
EUR 304 |
Description: E2F8 Antibody detects endogenous levels of total E2F8. |
E2F8 Antibody |
DF2591 |
Affbiotech |
200ul |
EUR 304 |
Description: E2F8 antibody detects endogenous levels of total E2F8. |
E2F8 antibody |
70R-8752 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal E2F8 antibody |
E2F8 Antibody |
1-CSB-PA007349GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against E2F8. Recognizes E2F8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Polyclonal E2F8 Antibody (C-Term) |
APR07631G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human E2F8 (C-Term). This antibody is tested and proven to work in the following applications: |
Polyclonal E2F8 Antibody (internal region) |
APR07632G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human E2F8 (internal region). This antibody is tested and proven to work in the following applications: |
Polyclonal E2F8 antibody - middle region |
APR07634G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human E2F8 - middle region. This antibody is tested and proven to work in the following applications: |
E2F8 Conjugated Antibody |
C43312 |
SAB |
100ul |
EUR 397 |
E2F8 Conjugated Antibody |
C32173 |
SAB |
100ul |
EUR 397 |
anti- E2F8 antibody |
FNab02604 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: E2F transcription factor 8
- Uniprot ID: A0AVK6
- Gene ID: 79733
- Research Area: Signal Transduction, Metabolism, Developmental biology
|
Description: Antibody raised against E2F8 |
Anti-E2F8 antibody |
STJ23459 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of a family of transcription factors which regulate the expression of genes required for progression through the cell cycle. The encoded protein regulates progression from G1 to S phase by ensuring the nucleus divides at the proper time. Multiple alternatively spliced variants, encoding the same protein, have been identified. |
Anti-E2F8 antibody |
STJ191922 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to E2F8 |
E2F8 siRNA |
20-abx914863 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
E2F8 siRNA |
20-abx914864 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Mouse Transcription factor E2F8, E2f8 ELISA KIT |
ELI-09689m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Transcription factor E2F8, E2F8 ELISA KIT |
ELI-47590h |
Lifescience Market |
96 Tests |
EUR 824 |
E2F8 Blocking Peptide |
33R-7652 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of E2F8 antibody, catalog no. 70R-8752 |
E2F8 Blocking Peptide |
DF6269-BP |
Affbiotech |
1mg |
EUR 195 |
E2F8 Blocking Peptide |
DF2591-BP |
Affbiotech |
1mg |
EUR 195 |
E2F8 cloning plasmid |
CSB-CL007349HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1296
- Sequence: atggctcagcttgcagctatttgtaaaatgcagttagaagagcaatcaagtgaatccagacagaaagtgaaagtacagctggcaagatctggaccctgcaaaccagtagcccctctggaccccccagtgaatgctgagatggagctgacagcaccgtccctcatccagcccctgg
- Show more
|
Description: A cloning plasmid for the E2F8 gene. |
E2F8 cloning plasmid |
CSB-CL007349HU2-10ug |
Cusabio |
10ug |
EUR 839 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2604
- Sequence: atggagaacgaaaaggaaaatctcttttgtgagccacataaaaggggactaatgaaaacacctctgaaagaatccaccacagcaaatatcgtgttggcagagatccagcctgactttggccctttaaccacacctaccaagcccaaggaaggctctcagggagagccgtggacac
- Show more
|
Description: A cloning plasmid for the E2F8 gene. |
Mouse E2F8 shRNA Plasmid |
20-abx979955 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human E2F8 shRNA Plasmid |
20-abx962522 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Anti-E2F8 (3E9-2F5) |
YF-MA11660 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to E2F8 |
E2F Transcription Factor 8 (E2F8) Antibody |
20-abx112219 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
E2F Transcription Factor 8 (E2F8) Antibody |
abx122347-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
E2F Transcription Factor 8 (E2F8) Antibody |
abx145185-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
E2F Transcription Factor 8 (E2F8) Antibody |
abx431042-200ul |
Abbexa |
200 ul |
EUR 286 |
- Shipped within 1-3 working days.
|
E2F Transcription Factor 8 (E2F8) Antibody |
abx232604-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
E2F Transcription Factor 8 (E2F8) Antibody |
20-abx001049 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Monoclonal E2F8 Antibody (monoclonal) (M01), Clone: S1 |
APR07633G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human E2F8 (monoclonal) (M01). The antibodies are raised in mouse and are from clone S1. This antibody is applicable in WB |
E2F8 ORF Vector (Human) (pORF) |
ORF003359 |
ABM |
1.0 ug DNA |
EUR 95 |
E2F8 ORF Vector (Human) (pORF) |
ORF012896 |
ABM |
1.0 ug DNA |
EUR 354 |
E2f8 ORF Vector (Mouse) (pORF) |
ORF043532 |
ABM |
1.0 ug DNA |
EUR 506 |
E2f8 sgRNA CRISPR Lentivector set (Mouse) |
K4865001 |
ABM |
3 x 1.0 ug |
EUR 339 |
E2F8 sgRNA CRISPR Lentivector set (Human) |
K0648801 |
ABM |
3 x 1.0 ug |
EUR 339 |
E2f8 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4865002 |
ABM |
1.0 ug DNA |
EUR 154 |
E2f8 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4865003 |
ABM |
1.0 ug DNA |
EUR 154 |
E2f8 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4865004 |
ABM |
1.0 ug DNA |
EUR 154 |
E2F8 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0648802 |
ABM |
1.0 ug DNA |
EUR 154 |
E2F8 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0648803 |
ABM |
1.0 ug DNA |
EUR 154 |
E2F8 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0648804 |
ABM |
1.0 ug DNA |
EUR 154 |
E2F8 Protein Vector (Mouse) (pPB-C-His) |
PV174126 |
ABM |
500 ng |
EUR 1065 |
E2F8 Protein Vector (Mouse) (pPB-N-His) |
PV174127 |
ABM |
500 ng |
EUR 1065 |
E2F8 Protein Vector (Mouse) (pPM-C-HA) |
PV174128 |
ABM |
500 ng |
EUR 1065 |
E2F8 Protein Vector (Mouse) (pPM-C-His) |
PV174129 |
ABM |
500 ng |
EUR 1065 |
E2F8 Protein Vector (Human) (pPB-C-His) |
PV013433 |
ABM |
500 ng |
EUR 329 |
E2F8 Protein Vector (Human) (pPB-N-His) |
PV013434 |
ABM |
500 ng |
EUR 329 |
E2F8 Protein Vector (Human) (pPM-C-HA) |
PV013435 |
ABM |
500 ng |
EUR 329 |
E2F8 Protein Vector (Human) (pPM-C-His) |
PV013436 |
ABM |
500 ng |
EUR 329 |
E2F8 Protein Vector (Human) (pPB-C-His) |
PV051581 |
ABM |
500 ng |
EUR 481 |
E2F8 Protein Vector (Human) (pPB-N-His) |
PV051582 |
ABM |
500 ng |
EUR 481 |
E2F8 Protein Vector (Human) (pPM-C-HA) |
PV051583 |
ABM |
500 ng |
EUR 481 |
E2F8 Protein Vector (Human) (pPM-C-His) |
PV051584 |
ABM |
500 ng |
EUR 481 |
E2f8 3'UTR GFP Stable Cell Line |
TU155538 |
ABM |
1.0 ml |
Ask for price |
E2f8 3'UTR Luciferase Stable Cell Line |
TU105538 |
ABM |
1.0 ml |
Ask for price |
E2f8 3'UTR Luciferase Stable Cell Line |
TU203739 |
ABM |
1.0 ml |
Ask for price |
E2f8 3'UTR GFP Stable Cell Line |
TU253739 |
ABM |
1.0 ml |
Ask for price |
E2F8 3'UTR GFP Stable Cell Line |
TU056509 |
ABM |
1.0 ml |
EUR 1394 |
E2F8 3'UTR Luciferase Stable Cell Line |
TU006509 |
ABM |
1.0 ml |
EUR 1394 |
Human E2F Transcription Factor 8 (E2F8) ELISA Kit |
abx387031-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
E2F8 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV702057 |
ABM |
1.0 ug DNA |
EUR 450 |
E2F8 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV702061 |
ABM |
1.0 ug DNA |
EUR 450 |
E2F8 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV702062 |
ABM |
1.0 ug DNA |
EUR 450 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
E2F8 Rabbit Polyclonal Antibody