FBF1 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

FBF1 Polyclonal Antibody

ABP58533-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human FBF1 protein at amino acid sequence of 730-810
  • Applications tips:
Description: A polyclonal antibody for detection of FBF1 from Human, Mouse. This FBF1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FBF1 protein at amino acid sequence of 730-810

FBF1 Polyclonal Antibody

ABP58533-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human FBF1 protein at amino acid sequence of 730-810
  • Applications tips:
Description: A polyclonal antibody for detection of FBF1 from Human, Mouse. This FBF1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FBF1 protein at amino acid sequence of 730-810

FBF1 Rabbit pAb

A18516-100ul 100 ul
EUR 308

FBF1 Rabbit pAb

A18516-200ul 200 ul
EUR 459

FBF1 Rabbit pAb

A18516-20ul 20 ul
EUR 183

FBF1 Rabbit pAb

A18516-50ul 50 ul
EUR 223

FBF1 Antibody

ABD10103 100 ug
EUR 438

FBF1 Antibody

44514-100ul 100ul
EUR 252

FBF1 Antibody

44514-50ul 50ul
EUR 187

FBF1 antibody

70R-17246 50 ul
EUR 435
Description: Rabbit polyclonal FBF1 antibody

FBF1 Antibody

DF10103 200ul
EUR 304
Description: FBF1 Antibody detects endogenous levels of total FBF1.

FBF1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FBF1. Recognizes FBF1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

FBF1 Conjugated Antibody

C44514 100ul
EUR 397

anti- FBF1 antibody

FNab03025 100µg
EUR 505.25
  • Immunogen: Fas(TNFRSF6) binding factor 1
  • Uniprot ID: Q8TES7
  • Gene ID: 85302
  • Research Area: Signal Transduction
Description: Antibody raised against FBF1

anti- FBF1 antibody

FNab03026 100µg
EUR 585
  • Immunogen: Fas(TNFRSF6) binding factor 1
  • Uniprot ID: Q8TES7
  • Gene ID: 85302
  • Research Area: Signal Transduction
Description: Antibody raised against FBF1

Anti-FBF1 antibody

PAab03025 100 ug
EUR 355

Anti-FBF1 antibody

PAab03026 100 ug
EUR 412

Anti-FBF1 antibody

STJ11100467 100 µl
EUR 277

Anti-FBF1 antibody

STJ191845 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FBF1


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FBF1 Blocking Peptide

DF10103-BP 1mg
EUR 195

FBF1 cloning plasmid

CSB-CL819480HU1-10ug 10ug
EUR 483
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1335
  • Sequence: atggagcggctccgggagctgcagcgggcgtccatcctagacatgcgcagagaccacgaggagcagctgcagcggctaaagctgctgaaggaccgagaggtcgatgcggccaccagtgccacctcccacacgcggtccctgaatagcatcatccaccagatggagaagttctcca
  • Show more
Description: A cloning plasmid for the FBF1 gene.

FBF1 cloning plasmid

CSB-CL819480HU2-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2493
  • Sequence: atggcaccaaaaaccaagaaaggatgtaaagtgacactacctgagaagcctgttaaactagcttcacataccagagacaccacaggtgtatctcagatgttcccttcttcaaaggcgagaacaaagtccctcctgggtgatgatgtcttcagcaccatggcaggcctggaagaag
  • Show more
Description: A cloning plasmid for the FBF1 gene.

Mouse FBF1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human FBF1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF009570 96 Tests
EUR 689

Fas (TNFRSF6) Binding Factor 1 (FBF1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fas (TNFRSF6) Binding Factor 1 (FBF1) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fas (TNFRSF6) Binding Factor 1 (FBF1) Antibody

abx233025-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Fas (TNFRSF6) Binding Factor 1 (FBF1) Antibody

abx233026-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

FBF1 ORF Vector (Human) (pORF)

ORF003942 1.0 ug DNA
EUR 95

Fbf1 ORF Vector (Mouse) (pORF)

ORF044611 1.0 ug DNA
EUR 506

FBF1 sgRNA CRISPR Lentivector set (Human)

K0760201 3 x 1.0 ug
EUR 339

Fbf1 sgRNA CRISPR Lentivector set (Mouse)

K4737101 3 x 1.0 ug
EUR 339

FBF1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0760202 1.0 ug DNA
EUR 154

FBF1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0760203 1.0 ug DNA
EUR 154

FBF1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0760204 1.0 ug DNA
EUR 154

Fbf1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4737102 1.0 ug DNA
EUR 154

Fbf1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4737103 1.0 ug DNA
EUR 154

Fbf1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4737104 1.0 ug DNA
EUR 154

FBF1 Protein Vector (Mouse) (pPB-C-His)

PV178442 500 ng
EUR 1065

FBF1 Protein Vector (Mouse) (pPB-N-His)

PV178443 500 ng
EUR 1065

FBF1 Protein Vector (Mouse) (pPM-C-HA)

PV178444 500 ng
EUR 1065

FBF1 Protein Vector (Mouse) (pPM-C-His)

PV178445 500 ng
EUR 1065

FBF1 Protein Vector (Human) (pPB-C-His)

PV015765 500 ng
EUR 329

FBF1 Protein Vector (Human) (pPB-N-His)

PV015766 500 ng
EUR 329

FBF1 Protein Vector (Human) (pPM-C-HA)

PV015767 500 ng
EUR 329

FBF1 Protein Vector (Human) (pPM-C-His)

PV015768 500 ng
EUR 329

Fbf1 3'UTR GFP Stable Cell Line

TU156377 1.0 ml Ask for price

FBF1 3'UTR Luciferase Stable Cell Line

TU007738 1.0 ml
EUR 1521

Fbf1 3'UTR Luciferase Stable Cell Line

TU106377 1.0 ml Ask for price

FBF1 3'UTR GFP Stable Cell Line

TU057738 1.0 ml
EUR 1521

Mouse Fas- binding factor 1, Fbf1 ELISA KIT

ELI-09864m 96 Tests
EUR 865

Human Fas- binding factor 1, FBF1 ELISA KIT

ELI-20798h 96 Tests
EUR 824

Chicken Fas- binding factor 1 homolog, FBF1 ELISA KIT

ELI-27439c 96 Tests
EUR 928

Human Fas (TNFRSF6) Binding Factor 1 (FBF1) ELISA Kit

abx387307-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

FBF1 Rabbit Polyclonal Antibody