GAR1 Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
GAR1 Polyclonal Antibody |
ABP58607-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human GAR1 protein at amino acid sequence of 110-190
- Applications tips:
|
Description: A polyclonal antibody for detection of GAR1 from Human, Mouse, Rat. This GAR1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GAR1 protein at amino acid sequence of 110-190 |
GAR1 Polyclonal Antibody |
ABP58607-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human GAR1 protein at amino acid sequence of 110-190
- Applications tips:
|
Description: A polyclonal antibody for detection of GAR1 from Human, Mouse, Rat. This GAR1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GAR1 protein at amino acid sequence of 110-190 |
GAR1 Polyclonal Antibody |
ES10659-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against GAR1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
GAR1 Polyclonal Antibody |
ES10659-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against GAR1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
GAR1 Rabbit pAb |
A12748-100ul |
Abclonal |
100 ul |
EUR 308 |
GAR1 Rabbit pAb |
A12748-200ul |
Abclonal |
200 ul |
EUR 459 |
GAR1 Rabbit pAb |
A12748-20ul |
Abclonal |
20 ul |
EUR 183 |
GAR1 Rabbit pAb |
A12748-50ul |
Abclonal |
50 ul |
EUR 223 |
GAR1 antibody |
70R-17424 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal GAR1 antibody |
GAR1 Antibody |
43554-100ul |
SAB |
100ul |
EUR 252 |
GAR1 Antibody |
1-CSB-PA878917LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GAR1. Recognizes GAR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
GAR1 Antibody |
1-CSB-PA009257GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against GAR1. Recognizes GAR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
GAR1 Polyclonal Antibody, HRP Conjugated |
A67631 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
GAR1 Polyclonal Antibody, FITC Conjugated |
A67632 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
GAR1 Polyclonal Antibody, Biotin Conjugated |
A67633 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
GAR1 Conjugated Antibody |
C43554 |
SAB |
100ul |
EUR 397 |
anti- GAR1 antibody |
FNab03346 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500-1:1000
- IP: 1:200-1:1000
- IHC: 1:20-1:200
- IF: 1:50-1:500
- Immunogen: GAR1 ribonucleoprotein homolog(yeast)
- Uniprot ID: Q9NY12
- Gene ID: 54433
- Research Area: Metabolism
|
Description: Antibody raised against GAR1 |
Anti-GAR1 antibody |
STJ114621 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the H/ACA snoRNPs (small nucleolar ribonucleoproteins) gene family. snoRNPs are involved in various aspects of rRNA processing and modification and have been classified into two families: C/D and H/ACA. The H/ACA snoRNPs also include the DKC1, NOLA2 and NOLA3 proteins. These four H/ACA snoRNP proteins localize to the dense fibrillar components of nucleoli and to coiled (Cajal) bodies in the nucleus. Both 18S rRNA production and rRNA pseudouridylation are impaired if any one of the four proteins is depleted. These four H/ACA snoRNP proteins are also components of the telomerase complex. The encoded protein of this gene contains two glycine- and arginine-rich domains and is related to Saccharomyces cerevisiae Gar1p. Two splice variants have been found for this gene. |
Anti-GAR1 antibody |
STJ191817 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to GAR1 |
GAR1 siRNA |
20-abx902094 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GAR1 siRNA |
20-abx917583 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GAR1 siRNA |
20-abx917584 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GAR1 Antibody, HRP conjugated |
1-CSB-PA878917LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GAR1. Recognizes GAR1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
GAR1 Antibody, FITC conjugated |
1-CSB-PA878917LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GAR1. Recognizes GAR1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
GAR1 Antibody, Biotin conjugated |
1-CSB-PA878917LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GAR1. Recognizes GAR1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
GAR1 cloning plasmid |
CSB-CL878917HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 654
- Sequence: atgtcttttcgaggcggaggtcgtggaggctttaatcgaggtggtggaggtggcggcttcaaccgaggcggcagcagcaaccacttccgaggtggaggcggcggtggaggcggcggcaatttcagaggcggcggcaggggaggatttggacgagggggtggccgcggaggctttaa
- Show more
|
Description: A cloning plasmid for the GAR1 gene. |
GAR1 Rabbit Polyclonal Antibody