GAR1 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

GAR1 Polyclonal Antibody
ABP58607-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human GAR1 protein at amino acid sequence of 110-190
  • Applications tips:
Description: A polyclonal antibody for detection of GAR1 from Human, Mouse, Rat. This GAR1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GAR1 protein at amino acid sequence of 110-190

GAR1 Polyclonal Antibody
ABP58607-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human GAR1 protein at amino acid sequence of 110-190
  • Applications tips:
Description: A polyclonal antibody for detection of GAR1 from Human, Mouse, Rat. This GAR1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GAR1 protein at amino acid sequence of 110-190

GAR1 Polyclonal Antibody
ES10659-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GAR1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GAR1 Polyclonal Antibody
ES10659-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GAR1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GAR1 Rabbit pAb
A12748-100ul 100 ul
EUR 308

GAR1 Rabbit pAb
A12748-200ul 200 ul
EUR 459

GAR1 Rabbit pAb
A12748-20ul 20 ul
EUR 183

GAR1 Rabbit pAb
A12748-50ul 50 ul
EUR 223

GAR1 antibody
70R-17424 50 ul
EUR 435
Description: Rabbit polyclonal GAR1 antibody

GAR1 Antibody
43554-100ul 100ul
EUR 252

GAR1 Antibody
1-CSB-PA878917LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GAR1. Recognizes GAR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

GAR1 Antibody
1-CSB-PA009257GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GAR1. Recognizes GAR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

GAR1 Polyclonal Antibody, HRP Conjugated
A67631 100 µg
EUR 570.55
Description: fast delivery possible

GAR1 Polyclonal Antibody, FITC Conjugated
A67632 100 µg
EUR 570.55
Description: reagents widely cited

GAR1 Polyclonal Antibody, Biotin Conjugated
A67633 100 µg
EUR 570.55
Description: Ask the seller for details

GAR1 Conjugated Antibody
C43554 100ul
EUR 397

anti- GAR1 antibody
FNab03346 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IP: 1:200-1:1000
  • IHC: 1:20-1:200
  • IF: 1:50-1:500
  • Immunogen: GAR1 ribonucleoprotein homolog(yeast)
  • Uniprot ID: Q9NY12
  • Gene ID: 54433
  • Research Area: Metabolism
Description: Antibody raised against GAR1

Anti-GAR1 antibody
PAab03346 100 ug
EUR 355

Anti-GAR1 antibody
STJ114621 100 µl
EUR 277
Description: This gene is a member of the H/ACA snoRNPs (small nucleolar ribonucleoproteins) gene family. snoRNPs are involved in various aspects of rRNA processing and modification and have been classified into two families: C/D and H/ACA. The H/ACA snoRNPs also include the DKC1, NOLA2 and NOLA3 proteins. These four H/ACA snoRNP proteins localize to the dense fibrillar components of nucleoli and to coiled (Cajal) bodies in the nucleus. Both 18S rRNA production and rRNA pseudouridylation are impaired if any one of the four proteins is depleted. These four H/ACA snoRNP proteins are also components of the telomerase complex. The encoded protein of this gene contains two glycine- and arginine-rich domains and is related to Saccharomyces cerevisiae Gar1p. Two splice variants have been found for this gene.

Anti-GAR1 antibody
STJ191817 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GAR1

GAR1 siRNA
20-abx902094
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GAR1 siRNA
20-abx917583
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GAR1 siRNA
20-abx917584
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GAR1 Antibody, HRP conjugated
1-CSB-PA878917LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GAR1. Recognizes GAR1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GAR1 Antibody, FITC conjugated
1-CSB-PA878917LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GAR1. Recognizes GAR1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GAR1 Antibody, Biotin conjugated
1-CSB-PA878917LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GAR1. Recognizes GAR1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GAR1 cloning plasmid
CSB-CL878917HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 654
  • Sequence: atgtcttttcgaggcggaggtcgtggaggctttaatcgaggtggtggaggtggcggcttcaaccgaggcggcagcagcaaccacttccgaggtggaggcggcggtggaggcggcggcaatttcagaggcggcggcaggggaggatttggacgagggggtggccgcggaggctttaa
  • Show more
Description: A cloning plasmid for the GAR1 gene.

pCMV-SPORT6-GAR1
PVT12527 2 ug
EUR 391

GAR1 ELISA KIT|Human
EF009780 96 Tests
EUR 689

GAR1 Rabbit Polyclonal Antibody