GBP2 Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
GBP2 Polyclonal Antibody |
ABP58613-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human GBP2 protein at amino acid sequence of 160-240
- Applications tips:
|
Description: A polyclonal antibody for detection of GBP2 from Human. This GBP2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GBP2 protein at amino acid sequence of 160-240 |
GBP2 Polyclonal Antibody |
ABP58613-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human GBP2 protein at amino acid sequence of 160-240
- Applications tips:
|
Description: A polyclonal antibody for detection of GBP2 from Human. This GBP2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GBP2 protein at amino acid sequence of 160-240 |
GBP2 Polyclonal Antibody |
ABP58613-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human GBP2 protein at amino acid sequence of 160-240
- Applications tips:
|
Description: A polyclonal antibody for detection of GBP2 from Human. This GBP2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GBP2 protein at amino acid sequence of 160-240 |
GBP2 Rabbit pAb |
A12994-100ul |
Abclonal |
100 ul |
EUR 308 |
GBP2 Rabbit pAb |
A12994-200ul |
Abclonal |
200 ul |
EUR 459 |
GBP2 Rabbit pAb |
A12994-20ul |
Abclonal |
20 ul |
EUR 183 |
GBP2 Rabbit pAb |
A12994-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal GBP2 Antibody (Center) |
APR16101G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GBP2 (Center). This antibody is tested and proven to work in the following applications: |
GBP2 antibody |
70R-5725 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal GBP2 antibody raised against the N terminal of GBP2 |
GBP2 antibody |
70R-4040 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal GBP2 antibody raised against the N terminal of GBP2 |
GBP2 Antibody |
44802-100ul |
SAB |
100ul |
EUR 252 |
GBP2 Antibody |
44802-50ul |
SAB |
50ul |
EUR 187 |
GBP2 antibody |
10R-4184 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal GBP2 antibody |
GBP2 antibody |
10R-4186 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal GBP2 antibody |
GBP2 antibody |
10R-4188 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal GBP2 antibody |
GBP2 antibody |
10R-4191 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal GBP2 antibody |
GBP2 antibody |
10R-4192 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal GBP2 antibody |
GBP2 antibody |
10R-4193 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal GBP2 antibody |
GBP2 antibody |
70R-17437 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal GBP2 antibody |
GBP2 Antibody |
DF2499 |
Affbiotech |
200ul |
EUR 304 |
Description: GBP2 antibody detects endogenous levels of total GBP2. |
GBP2 Antibody |
1-CSB-PA009298GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against GBP2. Recognizes GBP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
GBP2 Antibody |
1-CSB-PA009298LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GBP2. Recognizes GBP2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200 |
[KO Validated] GBP2 Rabbit pAb |
A19874-100ul |
Abclonal |
100 ul |
EUR 410 |
[KO Validated] GBP2 Rabbit pAb |
A19874-200ul |
Abclonal |
200 ul |
EUR 571 |
[KO Validated] GBP2 Rabbit pAb |
A19874-20ul |
Abclonal |
20 ul |
EUR 221 |
[KO Validated] GBP2 Rabbit pAb |
A19874-50ul |
Abclonal |
50 ul |
EUR 287 |
GBP2 Conjugated Antibody |
C44802 |
SAB |
100ul |
EUR 397 |
anti- GBP2 antibody |
FNab03374 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500-1:3000
- IHC: 1:50-1:500
- Immunogen: guanylate binding protein 2, interferon-inducible
- Uniprot ID: P32456
- Gene ID: 2634
- Research Area: Neuroscience
|
Description: Antibody raised against GBP2 |
Anti-GBP2 antibody |
STJ11100750 |
St John's Laboratory |
100 µl |
EUR 413 |
Description: This gene belongs to the guanine-binding protein (GBP) family, which includes interferon-induced proteins that can bind to guanine nucleotides (GMP, GDP and GTP). The encoded protein is a GTPase which hydrolyzes GTP, predominantly to GDP. The protein may play a role as a marker of squamous cell carcinomas. |
Anti-GBP2 antibody |
STJ114963 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene belongs to the guanine-binding protein (GBP) family, which includes interferon-induced proteins that can bind to guanine nucleotides (GMP, GDP and GTP). The encoded protein is a GTPase which hydrolyzes GTP, predominantly to GDP. The protein may play a role as a marker of squamous cell carcinomas. |
Anti-GBP2 antibody |
STJ191848 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to GBP2 |
GBP2 siRNA |
20-abx902104 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GBP2 siRNA |
20-abx917651 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GBP2 siRNA |
20-abx917652 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-GBP2 |
YF-PA11970 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to GBP2 |
anti-GBP2 |
YF-PA11971 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to GBP2 |
anti-GBP2 |
YF-PA11972 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to GBP2 |
anti-GBP2 |
YF-PA11973 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to GBP2 |
GBP2 Antibody, HRP conjugated |
1-CSB-PA009298LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GBP2. Recognizes GBP2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
GBP2 Antibody, FITC conjugated |
1-CSB-PA009298LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GBP2. Recognizes GBP2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
GBP2 Antibody, Biotin conjugated |
1-CSB-PA009298LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GBP2. Recognizes GBP2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
GBP2 cloning plasmid |
CSB-CL009298HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1776
- Sequence: atggctccagagatcaacttgccgggcccaatgagcctcattgataacactaaagggcagctggtggtgaatccagaagctctgaagatcctatctgcaattacgcagcctgtggtggtggtggcgattgtgggcctctatcgcacaggcaaatcctacctgatgaacaagctgg
- Show more
|
Description: A cloning plasmid for the GBP2 gene. |
GBP2 Blocking Peptide |
33R-3862 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GBP2 antibody, catalog no. 70R-5725 |
GBP2 Blocking Peptide |
33R-3881 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GBP2 antibody, catalog no. 70R-4040 |
GBP2 Blocking Peptide |
DF2499-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-GBP2 (2A10) |
YF-MA13198 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to GBP2 |
Rat GBP2 shRNA Plasmid |
20-abx987726 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse GBP2 shRNA Plasmid |
20-abx970480 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human GBP2 shRNA Plasmid |
20-abx951749 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
GBP2 Recombinant Protein (Human) |
RP012994 |
ABM |
100 ug |
Ask for price |
GBP2 Recombinant Protein (Rat) |
RP202328 |
ABM |
100 ug |
Ask for price |
GBP2 Recombinant Protein (Mouse) |
RP136049 |
ABM |
100 ug |
Ask for price |
Guanylate Binding Protein 2 (GBP2) Antibody |
abx145827-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Guanylate-Binding Protein 2 (GBP2) Antibody |
abx034879-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
GBP2 Rabbit Polyclonal Antibody