GBP2 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

GBP2 Polyclonal Antibody
ABP58613-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human GBP2 protein at amino acid sequence of 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of GBP2 from Human. This GBP2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GBP2 protein at amino acid sequence of 160-240

GBP2 Polyclonal Antibody
ES10690-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GBP2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

GBP2 Polyclonal Antibody
ES10690-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GBP2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

GBP2 Rabbit pAb
A12994-100ul 100 ul
EUR 308

GBP2 Rabbit pAb
A12994-200ul 200 ul
EUR 459

GBP2 Rabbit pAb
A12994-20ul 20 ul
EUR 183

GBP2 Rabbit pAb
A12994-50ul 50 ul
EUR 223

Polyclonal GBP2 Antibody (Center)
APR16101G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GBP2 (Center). This antibody is tested and proven to work in the following applications:

GBP2 antibody
70R-17437 50 ul
EUR 435
Description: Rabbit polyclonal GBP2 antibody

GBP2 antibody
10R-4184 100 ul
EUR 691
Description: Mouse monoclonal GBP2 antibody

GBP2 antibody
10R-4186 100 ul
EUR 691
Description: Mouse monoclonal GBP2 antibody

GBP2 antibody
10R-4188 100 ul
EUR 691
Description: Mouse monoclonal GBP2 antibody

GBP2 antibody
10R-4191 100 ul
EUR 691
Description: Mouse monoclonal GBP2 antibody

GBP2 antibody
10R-4192 100 ul
EUR 691
Description: Mouse monoclonal GBP2 antibody

GBP2 antibody
10R-4193 100 ul
EUR 691
Description: Mouse monoclonal GBP2 antibody

GBP2 Antibody
44802-100ul 100ul
EUR 252

GBP2 Antibody
44802-50ul 50ul
EUR 187

GBP2 Antibody
DF2499 200ul
EUR 304
Description: GBP2 antibody detects endogenous levels of total GBP2.

GBP2 antibody
70R-4040 50 ug
EUR 467
Description: Rabbit polyclonal GBP2 antibody raised against the N terminal of GBP2

GBP2 antibody
70R-5725 50 ug
EUR 467
Description: Rabbit polyclonal GBP2 antibody raised against the N terminal of GBP2

GBP2 Antibody
1-CSB-PA009298GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GBP2. Recognizes GBP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

GBP2 Antibody
1-CSB-PA009298LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GBP2. Recognizes GBP2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

GBP2 Antibody
ABD2499 100 ug
EUR 438

[KO Validated] GBP2 Rabbit pAb
A19874-100ul 100 ul
EUR 410

[KO Validated] GBP2 Rabbit pAb
A19874-200ul 200 ul
EUR 571

[KO Validated] GBP2 Rabbit pAb
A19874-20ul 20 ul
EUR 221

[KO Validated] GBP2 Rabbit pAb
A19874-50ul 50 ul
EUR 287

GBP2 Conjugated Antibody
C44802 100ul
EUR 397

anti- GBP2 antibody
FNab03374 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:3000
  • IHC: 1:50-1:500
  • Immunogen: guanylate binding protein 2, interferon-inducible
  • Uniprot ID: P32456
  • Gene ID: 2634
  • Research Area: Neuroscience
Description: Antibody raised against GBP2

Anti-GBP2 antibody
PAab03374 100 ug
EUR 355

Anti-GBP2 antibody
STJ11100750 100 µl
EUR 413
Description: This gene belongs to the guanine-binding protein (GBP) family, which includes interferon-induced proteins that can bind to guanine nucleotides (GMP, GDP and GTP). The encoded protein is a GTPase which hydrolyzes GTP, predominantly to GDP. The protein may play a role as a marker of squamous cell carcinomas.

Anti-GBP2 antibody
STJ114963 100 µl
EUR 277
Description: This gene belongs to the guanine-binding protein (GBP) family, which includes interferon-induced proteins that can bind to guanine nucleotides (GMP, GDP and GTP). The encoded protein is a GTPase which hydrolyzes GTP, predominantly to GDP. The protein may play a role as a marker of squamous cell carcinomas.

Anti-GBP2 antibody
STJ191848 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GBP2

Gbp2/ Rat Gbp2 ELISA Kit
ELI-27213r 96 Tests
EUR 886

GBP2 siRNA
20-abx902104
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GBP2 siRNA
20-abx917651
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GBP2 siRNA
20-abx917652
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-GBP2
YF-PA11970 50 ul
EUR 363
Description: Mouse polyclonal to GBP2

anti-GBP2
YF-PA11971 50 ug
EUR 363
Description: Mouse polyclonal to GBP2

anti-GBP2
YF-PA11972 100 ul
EUR 403
Description: Rabbit polyclonal to GBP2

anti-GBP2
YF-PA11973 100 ug
EUR 403
Description: Rabbit polyclonal to GBP2

GBP2 Antibody, HRP conjugated
1-CSB-PA009298LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GBP2. Recognizes GBP2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GBP2 Antibody, FITC conjugated
1-CSB-PA009298LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GBP2. Recognizes GBP2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GBP2 Antibody, Biotin conjugated
1-CSB-PA009298LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GBP2. Recognizes GBP2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GBP2 Blocking Peptide
33R-3862 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GBP2 antibody, catalog no. 70R-5725

GBP2 Blocking Peptide
33R-3881 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GBP2 antibody, catalog no. 70R-4040

GBP2 Blocking Peptide
DF2499-BP 1mg
EUR 195

GBP2 cloning plasmid
CSB-CL009298HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1776
  • Sequence: atggctccagagatcaacttgccgggcccaatgagcctcattgataacactaaagggcagctggtggtgaatccagaagctctgaagatcctatctgcaattacgcagcctgtggtggtggtggcgattgtgggcctctatcgcacaggcaaatcctacctgatgaacaagctgg
  • Show more
Description: A cloning plasmid for the GBP2 gene.

Anti-GBP2 (2A10)
YF-MA13198 100 ug
EUR 363
Description: Mouse monoclonal to GBP2

Mouse Gbp2 ELISA KIT
ELI-12519m 96 Tests
EUR 865

Human GBP2 ELISA KIT
ELI-27212h 96 Tests
EUR 824

GBP2 ELISA KIT|Human
EF009797 96 Tests
EUR 689

Rat GBP2 shRNA Plasmid
20-abx987726
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GBP2 shRNA Plasmid
20-abx970480
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GBP2 shRNA Plasmid
20-abx951749
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GBP2 Recombinant Protein (Human)
RP012994 100 ug Ask for price

GBP2 Recombinant Protein (Rat)
RP202328 100 ug Ask for price

GBP2 Recombinant Protein (Mouse)
RP136049 100 ug Ask for price

Guanylate-Binding Protein 2 (GBP2) Antibody
20-abx215566
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Guanylate Binding Protein 2 (GBP2) Antibody
abx145827-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

GBP2 Rabbit Polyclonal Antibody