HSPB3 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

HSPB3 Polyclonal Antibody
ES10697-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSPB3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
HSPB3 Polyclonal Antibody
ABP58825-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human HSPB3 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of HSPB3 from Human. This HSPB3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HSPB3 protein at amino acid sequence of 30-110
HSPB3 Polyclonal Antibody
ABP58825-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human HSPB3 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of HSPB3 from Human. This HSPB3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HSPB3 protein at amino acid sequence of 30-110
HSPB3 Polyclonal Antibody
ABP58825-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human HSPB3 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of HSPB3 from Human. This HSPB3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HSPB3 protein at amino acid sequence of 30-110
Human Heat Shock Protein Beta 3 (HSPb3) ELISA Kit
DLR-HSPb3-Hu-48T 48T
EUR 517
  • Should the Human Heat Shock Protein Beta 3 (HSPb3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Heat Shock Protein Beta 3 (HSPb3) in samples from tissue homogenates or other biological fluids.
Human Heat Shock Protein Beta 3 (HSPb3) ELISA Kit
DLR-HSPb3-Hu-96T 96T
EUR 673
  • Should the Human Heat Shock Protein Beta 3 (HSPb3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Heat Shock Protein Beta 3 (HSPb3) in samples from tissue homogenates or other biological fluids.
Human Heat Shock Protein Beta 3 (HSPb3) ELISA Kit
RD-HSPb3-Hu-48Tests 48 Tests
EUR 521
Human Heat Shock Protein Beta 3 (HSPb3) ELISA Kit
RD-HSPb3-Hu-96Tests 96 Tests
EUR 723
Human Heat Shock Protein Beta 3 (HSPb3) ELISA Kit
RDR-HSPb3-Hu-48Tests 48 Tests
EUR 544
Human Heat Shock Protein Beta 3 (HSPb3) ELISA Kit
RDR-HSPb3-Hu-96Tests 96 Tests
EUR 756
HSPB3 Antibody
ABD2505 100 ug
EUR 438
HSPB3 Antibody
44808-100ul 100ul
EUR 252
HSPB3 Antibody
44808-50ul 50ul
EUR 187
HSPB3 Antibody
DF2505 200ul
EUR 304
Description: HSPB3 antibody detects endogenous levels of total HSPB3.
Hspb3/ Rat Hspb3 ELISA Kit
ELI-30987r 96 Tests
EUR 886
HSPB3 Conjugated Antibody
C44808 100ul
EUR 397
Anti-HSPB3 antibody
STJ191855 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to HSPB3
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
HSPB3 cloning plasmid
CSB-CL614265HU-10ug 10ug
EUR 237
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 453
  • Sequence: atggcaaaaatcattttgaggcacctcatagagattccagtgcgttaccaggaagagtttgaagctcgaggtctagaagactgcaggctggatcatgctttatatgcactgcctgggccaaccatcgtggacctgaggaaaaccagggcagcgcagtctcctccagtggactcagc
  • Show more
Description: A cloning plasmid for the HSPB3 gene.
HSPB3 Blocking Peptide
DF2505-BP 1mg
EUR 195
Heat Shock Protein Beta 3 (HSPb3) Polyclonal Antibody (Human)
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HSPb3 (Met1~Lys150)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heat Shock Protein Beta 3 (HSPb3)
Mouse HSPB3 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat HSPB3 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human HSPB3 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
HSPB3 protein (His tag)
80R-1958 100 ug
EUR 322
Description: Recombinant human HSPB3 protein
HSPB3 Recombinant Protein (Human)
RP039934 100 ug Ask for price
HSPB3 Recombinant Protein (Rat)
RP205265 100 ug Ask for price
HSPB3 Recombinant Protein (Mouse)
RP142646 100 ug Ask for price
Heat Shock Protein Beta 3 (HSPb3) Polyclonal Antibody (Human), APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HSPb3 (Met1~Lys150)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heat Shock Protein Beta 3 (HSPb3). This antibody is labeled with APC.
Heat Shock Protein Beta 3 (HSPb3) Polyclonal Antibody (Human), Biotinylated
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HSPb3 (Met1~Lys150)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heat Shock Protein Beta 3 (HSPb3). This antibody is labeled with Biotin.
Heat Shock Protein Beta 3 (HSPb3) Polyclonal Antibody (Human), Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HSPb3 (Met1~Lys150)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heat Shock Protein Beta 3 (HSPb3). This antibody is labeled with Cy3.
Heat Shock Protein Beta 3 (HSPb3) Polyclonal Antibody (Human), FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HSPb3 (Met1~Lys150)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heat Shock Protein Beta 3 (HSPb3). This antibody is labeled with FITC.
Heat Shock Protein Beta 3 (HSPb3) Polyclonal Antibody (Human), HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HSPb3 (Met1~Lys150)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heat Shock Protein Beta 3 (HSPb3). This antibody is labeled with HRP.
Heat Shock Protein Beta 3 (HSPb3) Polyclonal Antibody (Human), PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HSPb3 (Met1~Lys150)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heat Shock Protein Beta 3 (HSPb3). This antibody is labeled with PE.
Heat Shock Protein Beta 3 (HSPb3) Polyclonal Antibody (Human), APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HSPb3 (Met1~Lys150)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Heat Shock Protein Beta 3 (HSPb3). This antibody is labeled with APC-Cy7.
Heat Shock Protein Beta 3 (HSPB3) Antibody
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Heat Shock Protein Beta 3 (HSPb3) Antibody
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Heat Shock Protein Beta 3 (HSPb3) Antibody
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Hspb3 ORF Vector (Rat) (pORF)
ORF068423 1.0 ug DNA
EUR 506
Hspb3 ORF Vector (Mouse) (pORF)
ORF047550 1.0 ug DNA
EUR 506
HSPB3 ORF Vector (Human) (pORF)
ORF013312 1.0 ug DNA
EUR 354
HSPB3 ELISA Kit (Human) (OKCD01255)
OKCD01255 96 Wells
EUR 831
Description: Description of target: Inhibitor of actin polymerization. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.29 ng/mL
Human Heat Shock Protein beta-3 (HSPB3) Antibody
32275-05111 150 ug
EUR 261
Hspb3 sgRNA CRISPR Lentivector set (Mouse)
K3493101 3 x 1.0 ug
EUR 339
HSPB3 sgRNA CRISPR Lentivector set (Human)
K0999401 3 x 1.0 ug
EUR 339
Hspb3 sgRNA CRISPR Lentivector set (Rat)
K6939101 3 x 1.0 ug
EUR 339
Hspb3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3493102 1.0 ug DNA
EUR 154
Hspb3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3493103 1.0 ug DNA
EUR 154
Hspb3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3493104 1.0 ug DNA
EUR 154
HSPB3 sgRNA CRISPR Lentivector (Human) (Target 1)
K0999402 1.0 ug DNA
EUR 154
HSPB3 sgRNA CRISPR Lentivector (Human) (Target 2)
K0999403 1.0 ug DNA
EUR 154
HSPB3 sgRNA CRISPR Lentivector (Human) (Target 3)
K0999404 1.0 ug DNA
EUR 154
Hspb3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6939102 1.0 ug DNA
EUR 154
Hspb3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6939103 1.0 ug DNA
EUR 154
Hspb3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6939104 1.0 ug DNA
EUR 154
HSPB3 Protein Vector (Human) (pPB-C-His)
PV053245 500 ng
EUR 481
HSPB3 Protein Vector (Human) (pPB-N-His)
PV053246 500 ng
EUR 481
HSPB3 Protein Vector (Human) (pPM-C-HA)
PV053247 500 ng
EUR 481
HSPB3 Protein Vector (Human) (pPM-C-His)
PV053248 500 ng
EUR 481
Recombinant Heat Shock Protein Beta 3 (HSPb3)
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q12988
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Heat Shock Protein Beta 3 expressed in: E.coli
Recombinant Human HSPB3 Protein, His, E.coli-1mg
QP12332-1mg 1mg
EUR 2757
Recombinant Human HSPB3 Protein, His, E.coli-20ug
QP12332-20ug 20ug
EUR 201
Recombinant Human HSPB3 Protein, His, E.coli-5ug
QP12332-5ug 5ug
EUR 155
HSPB3 Protein Vector (Rat) (pPB-C-His)
PV273690 500 ng
EUR 603
HSPB3 Protein Vector (Rat) (pPB-N-His)
PV273691 500 ng
EUR 603

HSPB3 Rabbit Polyclonal Antibody