HSPB7 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

HSPB7 Polyclonal Antibody

ABP58826-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human HSPB7 protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of HSPB7 from Human, Mouse. This HSPB7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HSPB7 protein at amino acid sequence of 100-180

HSPB7 Polyclonal Antibody

ABP58826-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human HSPB7 protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of HSPB7 from Human, Mouse. This HSPB7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HSPB7 protein at amino acid sequence of 100-180

HSPB7 Polyclonal Antibody

ES10698-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSPB7 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

HSPB7 Polyclonal Antibody

ES10698-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSPB7 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

HSPB7 Rabbit pAb

A18450-100ul 100 ul
EUR 308

HSPB7 Rabbit pAb

A18450-200ul 200 ul
EUR 459

HSPB7 Rabbit pAb

A18450-20ul 20 ul
EUR 183

HSPB7 Rabbit pAb

A18450-50ul 50 ul
EUR 223

Human Heat Shock Protein Beta 7 (HSPb7) ELISA Kit

DLR-HSPb7-Hu-48T 48T
EUR 517
  • Should the Human Heat Shock Protein Beta 7 (HSPb7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Heat Shock Protein Beta 7 (HSPb7) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Heat Shock Protein Beta 7 (HSPb7) ELISA Kit

DLR-HSPb7-Hu-96T 96T
EUR 673
  • Should the Human Heat Shock Protein Beta 7 (HSPb7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Heat Shock Protein Beta 7 (HSPb7) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Heat Shock Protein Beta 7 (HSPb7) ELISA Kit

RDR-HSPb7-Hu-48Tests 48 Tests
EUR 544

Human Heat Shock Protein Beta 7 (HSPb7) ELISA Kit

RDR-HSPb7-Hu-96Tests 96 Tests
EUR 756

Human Heat Shock Protein Beta 7 (HSPb7) ELISA Kit

RD-HSPb7-Hu-48Tests 48 Tests
EUR 521

Human Heat Shock Protein Beta 7 (HSPb7) ELISA Kit

RD-HSPb7-Hu-96Tests 96 Tests
EUR 723

HSPB7 antibody

70R-17847 50 ul
EUR 435
Description: Rabbit polyclonal HSPB7 antibody

HSPB7 Antibody

44809-100ul 100ul
EUR 252

HSPB7 Antibody

44809-50ul 50ul
EUR 187

HSPB7 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HSPB7. Recognizes HSPB7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

HSPB7 Antibody

DF2506 200ul
EUR 304
Description: HSPB7 antibody detects endogenous levels of total HSPB7.

Hspb7 antibody

70R-8510 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Hspb7 antibody

Hspb7 antibody

70R-8511 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Hspb7 antibody

HSPB7 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against HSPB7. Recognizes HSPB7 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

HSPB7 Antibody

ABD2506 100 ug
EUR 438

Polyclonal Hspb7 antibody - middle region

APR00806G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Hspb7 - middle region. This antibody is tested and proven to work in the following applications:

HSPB7 Polyclonal Antibody, Biotin Conjugated

A59439 100 µg
EUR 570.55
Description: The best epigenetics products

HSPB7 Polyclonal Antibody, FITC Conjugated

A59440 100 µg
EUR 570.55
Description: kits suitable for this type of research

HSPB7 Polyclonal Antibody, HRP Conjugated

A59441 100 µg
EUR 570.55
Description: fast delivery possible

Polyclonal Hspb7 antibody - C-terminal region

APR00807G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Hspb7 - C-terminal region. This antibody is tested and proven to work in the following applications:

HSPB7 Conjugated Antibody

C44809 100ul
EUR 397

anti- HSPB7 antibody

FNab04060 100µg
EUR 505.25
  • Immunogen: heat shock 27kDa protein family, member 7(cardiovascular)
  • Uniprot ID: Q9UBY9
  • Gene ID: 27129
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against HSPB7

Anti-HSPB7 antibody

PAab04060 100 ug
EUR 355

Anti-HSPB7 antibody

STJ11100404 100 µl
EUR 277

Anti-HSPB7 antibody

STJ191856 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to HSPB7

Hspb7/ Rat Hspb7 ELISA Kit

ELI-07939r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HSPB7 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HSPB7. Recognizes HSPB7 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HSPB7 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HSPB7. Recognizes HSPB7 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HSPB7 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HSPB7. Recognizes HSPB7 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Hspb7 Blocking Peptide

33R-2914 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Hspb7 antibody, catalog no. 70R-8510

Hspb7 Blocking Peptide

33R-9060 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Hspb7 antibody, catalog no. 70R-8511

HSPB7 Blocking Peptide

DF2506-BP 1mg
EUR 195

HSPB7 cloning plasmid

CSB-CL890668HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 513
  • Sequence: atgagccacagaacctcttccaccttccgagcggagagaagtttccattcctcttcttcttcctcctcctcttccacctcctcctcggcctcccgtgccctcccggcccaggacccgcccatggagaaggccctgagcatgttttccgatgactttggcagcttcatgcggcccca
  • Show more
Description: A cloning plasmid for the HSPB7 gene.

Anti-HSPB7 (1G12)

YF-MA20539 100 ug
EUR 363
Description: Mouse monoclonal to HSPB7

HSPB7 protein (His tag)

80R-1278 50 ug
EUR 397
Description: Purified recombinant Human HSPB7 protein


EF010248 96 Tests
EUR 689

Mouse HSPB7 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human HSPB7 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

HSPB7 Recombinant Protein (Human)

RP015379 100 ug Ask for price

HSPB7 Recombinant Protein (Rat)

RP205271 100 ug Ask for price

HSPB7 Recombinant Protein (Mouse)

RP142652 100 ug Ask for price

Heat Shock Protein Beta 7 (HSPb7) Polyclonal Antibody (Human, Pig)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HSPb7 (Met1~Ile170)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Heat Shock Protein Beta 7 (HSPb7)

Heat Shock Protein Beta 7 (HSPb7) Polyclonal Antibody (Human, Pig), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HSPb7 (Met1~Ile170)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Heat Shock Protein Beta 7 (HSPb7). This antibody is labeled with APC.

Heat Shock Protein Beta 7 (HSPb7) Polyclonal Antibody (Human, Pig), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HSPb7 (Met1~Ile170)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Heat Shock Protein Beta 7 (HSPb7). This antibody is labeled with Biotin.

Heat Shock Protein Beta 7 (HSPb7) Polyclonal Antibody (Human, Pig), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HSPb7 (Met1~Ile170)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Heat Shock Protein Beta 7 (HSPb7). This antibody is labeled with Cy3.

Heat Shock Protein Beta 7 (HSPb7) Polyclonal Antibody (Human, Pig), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HSPb7 (Met1~Ile170)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Heat Shock Protein Beta 7 (HSPb7). This antibody is labeled with FITC.

Heat Shock Protein Beta 7 (HSPb7) Polyclonal Antibody (Human, Pig), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HSPb7 (Met1~Ile170)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Heat Shock Protein Beta 7 (HSPb7). This antibody is labeled with HRP.

Heat Shock Protein Beta 7 (HSPb7) Polyclonal Antibody (Human, Pig), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HSPb7 (Met1~Ile170)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Heat Shock Protein Beta 7 (HSPb7). This antibody is labeled with PE.

Heat Shock Protein Beta 7 (HSPB7) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Heat Shock Protein Beta 7 (HSPB7) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Heat Shock Protein Beta 7 (HSPB7) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Heat Shock Protein Beta 7 (HSPb7) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Heat Shock Protein Beta 7 (HSPB7) Antibody

abx234060-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Heat Shock Protein Beta 7 (HSPB7) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Monoclonal HSPB7 Antibody (monoclonal) (M01), Clone: 3E12

AMM03640G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human HSPB7 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3E12. This antibody is applicable in WB and IHC, E

Hspb7 ORF Vector (Rat) (pORF)

ORF068425 1.0 ug DNA
EUR 506

HSPB7 ORF Vector (Human) (pORF)

ORF005127 1.0 ug DNA
EUR 95

Hspb7 ORF Vector (Mouse) (pORF)

ORF047552 1.0 ug DNA
EUR 506

HSPB7 Rabbit Polyclonal Antibody