IFI6 Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
IFI6 Polyclonal Antibody |
ES10713-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IFI6 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
IFI6 Polyclonal Antibody |
ABP58877-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human IFI6 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of IFI6 from Human. This IFI6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IFI6 protein |
IFI6 Polyclonal Antibody |
ABP58877-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human IFI6 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of IFI6 from Human. This IFI6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IFI6 protein |
IFI6 Polyclonal Antibody |
ABP58877-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human IFI6 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of IFI6 from Human. This IFI6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IFI6 protein |
IFI6 Rabbit pAb |
A6157-100ul |
Abclonal |
100 ul |
EUR 308 |
IFI6 Rabbit pAb |
A6157-200ul |
Abclonal |
200 ul |
EUR 459 |
IFI6 Rabbit pAb |
A6157-20ul |
Abclonal |
20 ul |
EUR 183 |
IFI6 Rabbit pAb |
A6157-50ul |
Abclonal |
50 ul |
EUR 223 |
IFI6 Antibody |
35228-100ul |
SAB |
100ul |
EUR 252 |
IFI6 Antibody |
35228-50ul |
SAB |
50ul |
EUR 187 |
IFI6 antibody |
38739-100ul |
SAB |
100ul |
EUR 252 |
IFI6 Antibody |
DF10115 |
Affbiotech |
200ul |
EUR 304 |
Description: IFI6 Antibody detects endogenous levels of total IFI6. |
IFI6 Antibody |
CSB-PA253751- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against IFI6. Recognizes IFI6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
IFI6 Antibody |
CSB-PA253751-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against IFI6. Recognizes IFI6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
Polyclonal IFI6 Antibody (N-term) |
APR07950G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IFI6 (N-term). This antibody is tested and proven to work in the following applications: |
IFI6 Conjugated Antibody |
C38739 |
SAB |
100ul |
EUR 397 |
Anti-IFI6 Antibody |
A08687 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal IFI6 Antibody. Validated in WB and tested in Human. |
Anti-IFI6 antibody |
STJ27910 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene was first identified as one of the many genes induced by interferon. The encoded protein may play a critical role in the regulation of apoptosis. A minisatellite that consists of 26 repeats of a 12 nucleotide repeating element resembling the mammalian splice donor consensus sequence begins near the end of the second exon. Alternatively spliced transcript variants that encode different isoforms by using the two downstream repeat units as splice donor sites have been described. |
Anti-IFI6 antibody |
STJ191871 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to IFI6 |
IFI6 siRNA |
20-abx920192 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
IFI6 cloning plasmid |
CSB-CL011016HU-10ug |
Cusabio |
10ug |
EUR 220 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 393
- Sequence: atgcggcagaaggcggtatcgcttttcttgtgctacctgctgctcttcacttgcagtggggtggaggcaggtaagaaaaagtgctcggagagctcggacagcggctccgggttctggaaggccctgaccttcatggccgtcggaggaggactcgcagtcgccgggctgcccgcgct
- Show more
|
Description: A cloning plasmid for the IFI6 gene. |
IFI6 Blocking Peptide |
DF10115-BP |
Affbiotech |
1mg |
EUR 195 |
Human IFI6 shRNA Plasmid |
20-abx951681 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
IFI6 Recombinant Protein (Human) |
RP015604 |
ABM |
100 ug |
Ask for price |
IFI6 ORF Vector (Human) (pORF) |
ORF005202 |
ABM |
1.0 ug DNA |
EUR 95 |
IFI6 ELISA Kit (Human) (OKEH02144) |
OKEH02144 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: This gene was first identified as one of the many genes induced by interferon. The encoded protein may play a critical role in the regulation of apoptosis. A minisatellite that consists of 26 repeats of a 12 nucleotide repeating element resembling the mammalian splice donor consensus sequence begins near the end of the second exon. Alternatively spliced transcript variants that encode different isoforms by using the two downstream repeat units as splice donor sites have been described.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.9 pg/mL |
IFI6 ELISA Kit (Bovine) (OKEH07705) |
OKEH07705 |
Aviva Systems Biology |
96 Wells |
EUR 1092 |
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: |
Interferon Alpha Inducible Protein 6 (IFI6) Antibody |
20-abx004709 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Interferon Alpha Inducible Protein 6 (IFI6) Antibody |
20-abx015094 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Interferon Alpha Inducible Protein 6 (IFI6) Antibody |
abx330737-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Interferon Alpha Inducible Protein 6 (IFI6) Antibody |
20-abx225231 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
IFI6 sgRNA CRISPR Lentivector set (Human) |
K1016501 |
ABM |
3 x 1.0 ug |
EUR 339 |
IFI6 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1016502 |
ABM |
1.0 ug DNA |
EUR 154 |
IFI6 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1016503 |
ABM |
1.0 ug DNA |
EUR 154 |
IFI6 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1016504 |
ABM |
1.0 ug DNA |
EUR 154 |
Human Interferon alpha-inducible protein 6 (IFI6) |
1-CSB-YP011016HU |
Cusabio |
-
EUR 430.00
-
EUR 234.00
-
EUR 1508.00
-
EUR 642.00
-
EUR 1009.00
-
EUR 291.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 12.4 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Interferon alpha-inducible protein 6(IFI6) expressed in Yeast |
Human Interferon alpha-inducible protein 6 (IFI6) |
1-CSB-EP011016HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 24.4 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Interferon alpha-inducible protein 6(IFI6) expressed in E.coli |
IFI6 Protein Vector (Human) (pPB-C-His) |
PV020805 |
ABM |
500 ng |
EUR 329 |
IFI6 Protein Vector (Human) (pPB-N-His) |
PV020806 |
ABM |
500 ng |
EUR 329 |
IFI6 Protein Vector (Human) (pPM-C-HA) |
PV020807 |
ABM |
500 ng |
EUR 329 |
IFI6 Protein Vector (Human) (pPM-C-His) |
PV020808 |
ABM |
500 ng |
EUR 329 |
IFI6 3'UTR Luciferase Stable Cell Line |
TU010442 |
ABM |
1.0 ml |
EUR 1394 |
IFI6 3'UTR GFP Stable Cell Line |
TU060442 |
ABM |
1.0 ml |
EUR 1394 |
Cow Interferon Alpha Inducible Protein 6 (IFI6) ELISA Kit |
abx515294-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human IFI6/ Interferon alpha-inducible protein 6 ELISA Kit |
E1214Hu |
Sunlong |
1 Kit |
EUR 605 |
Human IFI6(Interferon alpha-inducible protein 6) ELISA Kit |
EH1270 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 31.2-2000 pg/ml
- Uniprot ID: P09912
- Alias: IFI6/Interferon alpha-inducible protein 6/Interferon-induced protein 6-16(Ifi-6-16)/G1P3/FAM14C/IFI-6-16/6-16/IFI616
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml |
Human Interferon alpha- inducible protein 6, IFI6 ELISA KIT |
ELI-03678h |
Lifescience Market |
96 Tests |
EUR 824 |
Bovine Interferon alpha- inducible protein 6, IFI6 ELISA KIT |
ELI-03679b |
Lifescience Market |
96 Tests |
EUR 928 |
Human Interferon Alpha Inducible Protein 6 (IFI6) ELISA Kit |
abx250532-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IFI6 Rabbit Polyclonal Antibody