IFNA4 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

IFNA4 Polyclonal Antibody

ABP58887-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human IFNA4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of IFNA4 from Human. This IFNA4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IFNA4 protein

IFNA4 Polyclonal Antibody

ABP58887-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human IFNA4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of IFNA4 from Human. This IFNA4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IFNA4 protein

IFNA4 Polyclonal Antibody

ES10706-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IFNA4 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

IFNA4 Polyclonal Antibody

ES10706-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IFNA4 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Interferon Alpha 4 (IFNa4) ELISA Kit

DLR-IFNa4-Hu-48T 48T
EUR 425
  • Should the Human Interferon Alpha 4 (IFNa4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Interferon Alpha 4 (IFNa4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Interferon Alpha 4 (IFNa4) ELISA Kit

DLR-IFNa4-Hu-96T 96T
EUR 548
  • Should the Human Interferon Alpha 4 (IFNa4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Interferon Alpha 4 (IFNa4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Interferon Alpha 4 (IFNa4) ELISA Kit

RDR-IFNa4-Hu-48Tests 48 Tests
EUR 436

Human Interferon Alpha 4 (IFNa4) ELISA Kit

RDR-IFNa4-Hu-96Tests 96 Tests
EUR 601

Human Interferon Alpha 4 (IFNa4) ELISA Kit

RD-IFNa4-Hu-48Tests 48 Tests
EUR 418

Human Interferon Alpha 4 (IFNa4) ELISA Kit

RD-IFNa4-Hu-96Tests 96 Tests
EUR 575

IFNA4 Rabbit pAb

A8124-100ul 100 ul
EUR 308

IFNA4 Rabbit pAb

A8124-200ul 200 ul
EUR 459

IFNA4 Rabbit pAb

A8124-20ul 20 ul
EUR 183

IFNA4 Rabbit pAb

A8124-50ul 50 ul
EUR 223

IFNA4 Antibody

44812-100ul 100ul
EUR 252

IFNA4 Antibody

44812-50ul 50ul
EUR 187

IFNA4 Antibody

DF2515 200ul
EUR 304
Description: IFNA4 antibody detects endogenous levels of total IFNA4.

IFNA4 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against IFNA4. Recognizes IFNA4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

IFNA4 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IFNA4. Recognizes IFNA4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200

IFNA4 Antibody

ABD2515 100 ug
EUR 438

IFNA4 Polyclonal Antibody, HRP Conjugated

A56960 100 µg
EUR 570.55
Description: reagents widely cited

IFNA4 Polyclonal Antibody, FITC Conjugated

A56961 100 µg
EUR 570.55
Description: Ask the seller for details

IFNA4 Polyclonal Antibody, Biotin Conjugated

A56962 100 µg
EUR 570.55
Description: The best epigenetics products

IFNA4 Conjugated Antibody

C44812 100ul
EUR 397

Anti-IFNA4 antibody

STJ117849 100 µl
EUR 277

Anti-IFNA4 antibody

STJ191864 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to IFNA4

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Human)

  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IFNa4 (Ala10~Ala163)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Interferon Alpha 4 (IFNa4)

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Rat)

  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IFNa4 (Arg33~Lys189)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interferon Alpha 4 (IFNa4)


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA12567 50 ug
EUR 363
Description: Mouse polyclonal to IFNA4


YF-PA12568 100 ul
EUR 403
Description: Rabbit polyclonal to IFNA4


YF-PA12569 100 ug
EUR 403
Description: Rabbit polyclonal to IFNA4

IFNA4 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IFNA4. Recognizes IFNA4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

IFNA4 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IFNA4. Recognizes IFNA4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

IFNA4 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IFNA4. Recognizes IFNA4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Human), APC

  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IFNa4 (Ala10~Ala163)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Interferon Alpha 4 (IFNa4). This antibody is labeled with APC.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Human), Biotinylated

  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IFNa4 (Ala10~Ala163)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Interferon Alpha 4 (IFNa4). This antibody is labeled with Biotin.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Human), Cy3

  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IFNa4 (Ala10~Ala163)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Interferon Alpha 4 (IFNa4). This antibody is labeled with Cy3.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Human), FITC

  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IFNa4 (Ala10~Ala163)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Interferon Alpha 4 (IFNa4). This antibody is labeled with FITC.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Human), HRP

  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IFNa4 (Ala10~Ala163)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Interferon Alpha 4 (IFNa4). This antibody is labeled with HRP.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Human), PE

  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IFNa4 (Ala10~Ala163)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Interferon Alpha 4 (IFNa4). This antibody is labeled with PE.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Mouse, Rat)

  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IFNa4 (Asp26~Glu186)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Interferon Alpha 4 (IFNa4)

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Rat), APC

  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IFNa4 (Arg33~Lys189)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with APC.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Rat), Biotinylated

  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IFNa4 (Arg33~Lys189)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with Biotin.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Rat), Cy3

  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IFNa4 (Arg33~Lys189)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with Cy3.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Rat), FITC

  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IFNa4 (Arg33~Lys189)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with FITC.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Rat), HRP

  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IFNa4 (Arg33~Lys189)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with HRP.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Rat), PE

  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IFNa4 (Arg33~Lys189)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with PE.

IFNA4 Blocking Peptide

DF2515-BP 1mg
EUR 195

IFNA4 cloning plasmid

CSB-CL011040HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 570
  • Sequence: atggccctgtccttttctttactgatggccgtgctggtgctcagctacaaatccatctgttctctgggctgtgatctgcctcagacccacagcctgggtaataggagggccttgatactcctggcacaaatgggaagaatctctcatttctcctgcctgaaggacagacatgattt
  • Show more
Description: A cloning plasmid for the IFNA4 gene.

IFNA4 cloning plasmid

CSB-CL011040HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 570
  • Sequence: atggccctgtccttttctttactgatggccgtgctggtgctcagctacaaatccatctgttctctgggctgtgatctgcctcagacccacagcctgggtaataggagggccttgatactcctggcacaaatgggaagaatctctcatttctcctgcctgaaggacagacatgattt
  • Show more
Description: A cloning plasmid for the IFNA4 gene.

Interferon Alpha 4 (IFNA4) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Interferon Alpha 4 (IFNa4) Antibody

  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Interferon Alpha 4 (IFNa4) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Interferon Alpha 4 (IFNa4) Antibody

  • EUR 300.00
  • EUR 133.00
  • EUR 801.00
  • EUR 425.00
  • EUR 258.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Interferon Alpha 4 (IFNa4) Antibody

  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Interferon Alpha 4 (IFNA4) Antibody

abx034855-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Interferon Alpha 4 (IFNA4) Antibody

abx034855-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Interferon Alpha 4 (IFNA4) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Interferon Alpha 4 (IFNA4) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Human), APC-Cy7

  • EUR 527.00
  • EUR 5818.00
  • EUR 1552.00
  • EUR 698.00
  • EUR 301.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IFNa4 (Ala10~Ala163)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Interferon Alpha 4 (IFNa4). This antibody is labeled with APC-Cy7.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Mouse, Rat), APC

  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IFNa4 (Asp26~Glu186)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with APC.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Mouse, Rat), Biotinylated

  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IFNa4 (Asp26~Glu186)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with Biotin.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Mouse, Rat), Cy3

  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IFNa4 (Asp26~Glu186)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with Cy3.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Mouse, Rat), FITC

  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IFNa4 (Asp26~Glu186)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with FITC.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Mouse, Rat), HRP

  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IFNa4 (Asp26~Glu186)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with HRP.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Mouse, Rat), PE

  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IFNa4 (Asp26~Glu186)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with PE.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Rat), APC-Cy7

  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IFNa4 (Arg33~Lys189)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with APC-Cy7.

Interferon Alpha 4 (IFNa4) Antibody (Biotin)

  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Interferon Alpha 4 (IFNA4) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Interferon Alpha 4 (IFNA4) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Interferon Alpha 4 (IFNA4) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Interferon Alpha 4 (IFNa4) Polyclonal Antibody (Mouse, Rat), APC-Cy7

  • EUR 538.00
  • EUR 5962.00
  • EUR 1588.00
  • EUR 713.00
  • EUR 304.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IFNa4 (Asp26~Glu186)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Interferon Alpha 4 (IFNa4). This antibody is labeled with APC-Cy7.

Human IFNA4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse IFNA4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

IFNA4 Rabbit Polyclonal Antibody