ING2 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

ING2 Polyclonal Antibody

ABP58938-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ING2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ING2 from Human, Mouse. This ING2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ING2 protein

ING2 Polyclonal Antibody

ABP58938-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ING2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ING2 from Human, Mouse. This ING2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ING2 protein

ING2 Rabbit pAb

A12266-100ul 100 ul
EUR 308

ING2 Rabbit pAb

A12266-200ul 200 ul
EUR 459

ING2 Rabbit pAb

A12266-20ul 20 ul
EUR 183

ING2 Rabbit pAb

A12266-50ul 50 ul
EUR 223

ING2 Rabbit pAb

A8726-100ul 100 ul
EUR 308

ING2 Rabbit pAb

A8726-200ul 200 ul
EUR 459

ING2 Rabbit pAb

A8726-20ul 20 ul Ask for price

ING2 Rabbit pAb

A8726-50ul 50 ul Ask for price

ING2 Antibody

ABD2633 100 ug
EUR 438

ING2 Antibody

ABD8240 100 ug
EUR 438

ING2 Antibody

35779-100ul 100ul
EUR 252

ING2 antibody

10R-10245 50 ul
EUR 219
Description: Mouse monoclonal ING2 antibody

ING2 antibody

70R-17969 50 ul
EUR 435
Description: Rabbit polyclonal ING2 antibody

ING2 Antibody

DF8240 200ul
EUR 304
Description: ING2 Antibody detects endogenous levels of total ING2.

ING2 Antibody

DF2633 200ul
EUR 304
Description: ING2 antibody detects endogenous levels of total ING2.

ING2 Antibody

1-CSB-PA011713GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ING2. Recognizes ING2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

ING2 Antibody

1-CSB-PA777986
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ING2. Recognizes ING2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

ING2 Antibody

1-CSB-PA266125
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ING2. Recognizes ING2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

ING2 Conjugated Antibody

C35779 100ul
EUR 397

anti- ING2 antibody

FNab04310 100µg
EUR 505.25
  • Immunogen: inhibitor of growth family, member 2
  • Uniprot ID: Q9H160
  • Gene ID: 3622
  • Research Area: Cancer, Signal Transduction, Metabolism
Description: Antibody raised against ING2

Anti-ING2 antibody

PAab04310 100 ug
EUR 355

Anti-ING2 antibody

STJ111390 100 µl
EUR 277
Description: This gene is a member of the inhibitor of growth (ING) family. Members of the ING family associate with and modulate the activity of histone acetyltransferase (HAT) and histone deacetylase (HDAC) complexes and function in DNA repair and apoptosis. Alternative splicing results in multiple transcript variants.

Anti-ING2 antibody

STJ114156 100 µl
EUR 277
Description: This gene is a member of the inhibitor of growth (ING) family. Members of the ING family associate with and modulate the activity of histone acetyltransferase (HAT) and histone deacetylase (HDAC) complexes and function in DNA repair and apoptosis. Alternative splicing results in multiple transcript variants.

Anti-ING2 antibody

STJ191949 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ING2

ING2 siRNA

20-abx920605
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ING2 siRNA

20-abx920606
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-ING2

YF-PA12744 50 ul
EUR 363
Description: Mouse polyclonal to ING2

anti-ING2

YF-PA12745 50 ul
EUR 363
Description: Mouse polyclonal to ING2

Anti-ING2 / ING1L antibody

STJ70185 100 µg
EUR 359

ING2 cloning plasmid

CSB-CL867125HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 843
  • Sequence: atgttagggcagcagcagcagcaactgtactcgtcggctgcgctcctgaccggggagcggagccggctgctcacctgctacgtgcaggactaccttgagtgcgtggagtcgctgccccacgacatgcagaggaacgtgtctgtgctgcgagagctggacaacaaatatcaagaaac
  • Show more
Description: A cloning plasmid for the ING2 gene.

ING2 Blocking Peptide

DF8240-BP 1mg
EUR 195

ING2 Blocking Peptide

DF2633-BP 1mg
EUR 195

Anti-ING2 (1D1)

YF-MA13827 100 ug
EUR 363
Description: Mouse monoclonal to ING2

Mouse ING2 shRNA Plasmid

20-abx976900
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ING2 ELISA KIT|Human

EF010337 96 Tests
EUR 689

ING2 protein (His tag)

80R-3524 100 ug
EUR 327
Description: Purified recombinant ING2 protein (His tag)

Human ING2 shRNA Plasmid

20-abx952426
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ING2 Recombinant Protein (Human)

RP016141 100 ug Ask for price

pcDNA3.1-Flag-ING2 Plasmid

PVTB01081-2a 2 ug
EUR 356

ING2 Recombinant Protein (Rat)

RP206021 100 ug Ask for price

ING2 Recombinant Protein (Mouse)

RP143828 100 ug Ask for price

Inhibitor of Growth Protein 2 (ING2) Antibody

20-abx123607
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Inhibitor of Growth Protein 2 (ING2) Antibody

20-abx126007
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Inhibitor of Growth Protein 2 (ING2) Antibody

20-abx113133
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Inhibitor of Growth Protein 2 (ING2) Antibody

abx036708-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Inhibitor of Growth Protein 2 (ING2) Antibody

abx030998-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Inhibitor of Growth Protein 2 (ING2) Antibody

abx030998-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Inhibitor of Growth Protein 2 (ING2) Antibody

abx430244-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Inhibitor of Growth Protein 2 (ING2) Antibody

abx234310-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Inhibitor of Growth Protein 2 (ING2) Antibody

20-abx212901
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Inhibitor of Growth Protein 2 (ING2) Antibody

20-abx213330
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ING2 ORF Vector (Human) (pORF)

ORF005381 1.0 ug DNA
EUR 95

Ing2 ORF Vector (Rat) (pORF)

ORF068675 1.0 ug DNA
EUR 506

Ing2 ORF Vector (Mouse) (pORF)

ORF047944 1.0 ug DNA
EUR 506

Ing2 sgRNA CRISPR Lentivector set (Mouse)

K4089701 3 x 1.0 ug
EUR 339

ING2 sgRNA CRISPR Lentivector set (Human)

K1087801 3 x 1.0 ug
EUR 339

Ing2 sgRNA CRISPR Lentivector set (Rat)

K6641601 3 x 1.0 ug
EUR 339

Inhibitor Of Growth Protein 2 (ING2) Protein

20-abx261186
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Ing2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4089702 1.0 ug DNA
EUR 154

Ing2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4089703 1.0 ug DNA
EUR 154

Ing2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4089704 1.0 ug DNA
EUR 154

ING2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1087802 1.0 ug DNA
EUR 154

ING2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1087803 1.0 ug DNA
EUR 154

ING2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1087804 1.0 ug DNA
EUR 154

Ing2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6641602 1.0 ug DNA
EUR 154

Ing2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6641603 1.0 ug DNA
EUR 154

Ing2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6641604 1.0 ug DNA
EUR 154

Recombinant Human ING2 Protein, His, E.coli-1mg

QP12446-1mg 1mg
EUR 2757

Recombinant Human ING2 Protein, His, E.coli-20ug

QP12446-20ug 20ug
EUR 201

Recombinant Human ING2 Protein, His, E.coli-5ug

QP12446-5ug 5ug
EUR 155

ING2 Protein Vector (Human) (pPB-C-His)

PV021521 500 ng
EUR 329

ING2 Protein Vector (Human) (pPB-N-His)

PV021522 500 ng
EUR 329

ING2 Protein Vector (Human) (pPM-C-HA)

PV021523 500 ng
EUR 329

ING2 Protein Vector (Human) (pPM-C-His)

PV021524 500 ng
EUR 329

ING2 Protein Vector (Rat) (pPB-C-His)

PV274698 500 ng
EUR 603

ING2 Protein Vector (Rat) (pPB-N-His)

PV274699 500 ng
EUR 603

ING2 Protein Vector (Rat) (pPM-C-HA)

PV274700 500 ng
EUR 603

ING2 Protein Vector (Rat) (pPM-C-His)

PV274701 500 ng
EUR 603

ING2 Protein Vector (Mouse) (pPB-C-His)

PV191774 500 ng
EUR 603

ING2 Protein Vector (Mouse) (pPB-N-His)

PV191775 500 ng
EUR 603

ING2 Protein Vector (Mouse) (pPM-C-HA)

PV191776 500 ng
EUR 603

ING2 Protein Vector (Mouse) (pPM-C-His)

PV191777 500 ng
EUR 603

Ing2 3'UTR Luciferase Stable Cell Line

TU206292 1.0 ml Ask for price

Ing2 3'UTR GFP Stable Cell Line

TU160117 1.0 ml Ask for price

ING2 3'UTR Luciferase Stable Cell Line

TU011155 1.0 ml
EUR 1394

Ing2 3'UTR Luciferase Stable Cell Line

TU110117 1.0 ml Ask for price

ING2 3'UTR GFP Stable Cell Line

TU061155 1.0 ml
EUR 1394

Ing2 3'UTR GFP Stable Cell Line

TU256292 1.0 ml Ask for price

ING2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV621805 1.0 ug DNA
EUR 514

ING2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV621809 1.0 ug DNA
EUR 514

ING2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV621810 1.0 ug DNA
EUR 514

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody

ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ING2 Rabbit Polyclonal Antibody