ING2 Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
 ING2 Polyclonal Antibody |
|
ABP58938-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human ING2 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ING2 from Human, Mouse. This ING2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ING2 protein |
ING2 Polyclonal Antibody |
|
ABP58938-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human ING2 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ING2 from Human, Mouse. This ING2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ING2 protein |
 ING2 Rabbit pAb |
|
A12266-100ul |
Abclonal |
100 ul |
EUR 308 |
ING2 Rabbit pAb |
|
A12266-200ul |
Abclonal |
200 ul |
EUR 459 |
ING2 Rabbit pAb |
|
A12266-20ul |
Abclonal |
20 ul |
EUR 183 |
ING2 Rabbit pAb |
|
A12266-50ul |
Abclonal |
50 ul |
EUR 223 |
ING2 Rabbit pAb |
|
A8726-100ul |
Abclonal |
100 ul |
EUR 308 |
ING2 Rabbit pAb |
|
A8726-200ul |
Abclonal |
200 ul |
EUR 459 |
ING2 Rabbit pAb |
|
A8726-20ul |
Abclonal |
20 ul |
Ask for price |
ING2 Rabbit pAb |
|
A8726-50ul |
Abclonal |
50 ul |
Ask for price |
 ING2 Antibody |
|
35779-100ul |
SAB |
100ul |
EUR 252 |
 ING2 antibody |
|
10R-10245 |
Fitzgerald |
50 ul |
EUR 219 |
|
Description: Mouse monoclonal ING2 antibody |
ING2 antibody |
|
70R-17969 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal ING2 antibody |
ING2 Antibody |
|
DF8240 |
Affbiotech |
200ul |
EUR 304 |
|
Description: ING2 Antibody detects endogenous levels of total ING2. |
ING2 Antibody |
|
DF2633 |
Affbiotech |
200ul |
EUR 304 |
|
Description: ING2 antibody detects endogenous levels of total ING2. |
ING2 Antibody |
|
1-CSB-PA011713GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against ING2. Recognizes ING2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
ING2 Antibody |
|
1-CSB-PA777986 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against ING2. Recognizes ING2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200 |
ING2 Antibody |
|
1-CSB-PA266125 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against ING2. Recognizes ING2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
 ING2 Conjugated Antibody |
|
C35779 |
SAB |
100ul |
EUR 397 |
 anti- ING2 antibody |
|
FNab04310 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: inhibitor of growth family, member 2
- Uniprot ID: Q9H160
- Gene ID: 3622
- Research Area: Cancer, Signal Transduction, Metabolism
|
|
Description: Antibody raised against ING2 |
 Anti-ING2 antibody |
|
STJ111390 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene is a member of the inhibitor of growth (ING) family. Members of the ING family associate with and modulate the activity of histone acetyltransferase (HAT) and histone deacetylase (HDAC) complexes and function in DNA repair and apoptosis. Alternative splicing results in multiple transcript variants. |
Anti-ING2 antibody |
|
STJ114156 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene is a member of the inhibitor of growth (ING) family. Members of the ING family associate with and modulate the activity of histone acetyltransferase (HAT) and histone deacetylase (HDAC) complexes and function in DNA repair and apoptosis. Alternative splicing results in multiple transcript variants. |
Anti-ING2 antibody |
|
STJ191949 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to ING2 |
 ING2 siRNA |
|
20-abx920605 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ING2 siRNA |
|
20-abx920606 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-ING2 |
|
YF-PA12744 |
Abfrontier |
50 ul |
EUR 363 |
|
Description: Mouse polyclonal to ING2 |
anti-ING2 |
|
YF-PA12745 |
Abfrontier |
50 ul |
EUR 363 |
|
Description: Mouse polyclonal to ING2 |
 ING2 cloning plasmid |
|
CSB-CL867125HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 843
- Sequence: atgttagggcagcagcagcagcaactgtactcgtcggctgcgctcctgaccggggagcggagccggctgctcacctgctacgtgcaggactaccttgagtgcgtggagtcgctgccccacgacatgcagaggaacgtgtctgtgctgcgagagctggacaacaaatatcaagaaac
- Show more
|
|
Description: A cloning plasmid for the ING2 gene. |
 ING2 Blocking Peptide |
|
DF8240-BP |
Affbiotech |
1mg |
EUR 195 |
ING2 Blocking Peptide |
|
DF2633-BP |
Affbiotech |
1mg |
EUR 195 |
) Anti-ING2 (1D1) |
|
YF-MA13827 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to ING2 |
 Mouse ING2 shRNA Plasmid |
|
20-abx976900 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) ING2 protein (His tag) |
|
80R-3524 |
Fitzgerald |
100 ug |
EUR 327 |
|
Description: Purified recombinant ING2 protein (His tag) |
 Human ING2 shRNA Plasmid |
|
20-abx952426 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) ING2 Recombinant Protein (Human) |
|
RP016141 |
ABM |
100 ug |
Ask for price |
) ING2 Recombinant Protein (Rat) |
|
RP206021 |
ABM |
100 ug |
Ask for price |
) ING2 Recombinant Protein (Mouse) |
|
RP143828 |
ABM |
100 ug |
Ask for price |
 Antibody) Inhibitor of Growth Protein 2 (ING2) Antibody |
|
20-abx123607 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Inhibitor of Growth Protein 2 (ING2) Antibody |
|
20-abx126007 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Inhibitor of Growth Protein 2 (ING2) Antibody |
|
20-abx113133 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Inhibitor of Growth Protein 2 (ING2) Antibody |
|
abx036708-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Inhibitor of Growth Protein 2 (ING2) Antibody |
|
abx030998-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Inhibitor of Growth Protein 2 (ING2) Antibody |
|
abx030998-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Inhibitor of Growth Protein 2 (ING2) Antibody |
|
abx430244-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Inhibitor of Growth Protein 2 (ING2) Antibody |
|
abx234310-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Inhibitor of Growth Protein 2 (ING2) Antibody |
|
20-abx212901 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Inhibitor of Growth Protein 2 (ING2) Antibody |
|
20-abx213330 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 (pORF)) ING2 ORF Vector (Human) (pORF) |
|
ORF005381 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Ing2 ORF Vector (Rat) (pORF) |
|
ORF068675 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Ing2 ORF Vector (Mouse) (pORF) |
|
ORF047944 |
ABM |
1.0 ug DNA |
EUR 506 |
) Ing2 sgRNA CRISPR Lentivector set (Mouse) |
|
K4089701 |
ABM |
3 x 1.0 ug |
EUR 339 |
) ING2 sgRNA CRISPR Lentivector set (Human) |
|
K1087801 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Ing2 sgRNA CRISPR Lentivector set (Rat) |
|
K6641601 |
ABM |
3 x 1.0 ug |
EUR 339 |
 Protein) Inhibitor Of Growth Protein 2 (ING2) Protein |
|
20-abx261186 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
 (Target 1)) Ing2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4089702 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Ing2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4089703 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Ing2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4089704 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) ING2 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1087802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) ING2 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1087803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) ING2 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1087804 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Ing2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6641602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Ing2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6641603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Ing2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6641604 |
ABM |
1.0 ug DNA |
EUR 154 |
 Recombinant Human ING2 Protein, His, E.coli-1mg |
|
QP12446-1mg |
EnQuireBio |
1mg |
EUR 2757 |
 Recombinant Human ING2 Protein, His, E.coli-20ug |
|
QP12446-20ug |
EnQuireBio |
20ug |
EUR 201 |
 Recombinant Human ING2 Protein, His, E.coli-5ug |
|
QP12446-5ug |
EnQuireBio |
5ug |
EUR 155 |
 (pPB-C-His)) ING2 Protein Vector (Human) (pPB-C-His) |
|
PV021521 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) ING2 Protein Vector (Human) (pPB-N-His) |
|
PV021522 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) ING2 Protein Vector (Human) (pPM-C-HA) |
|
PV021523 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) ING2 Protein Vector (Human) (pPM-C-His) |
|
PV021524 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) ING2 Protein Vector (Rat) (pPB-C-His) |
|
PV274698 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) ING2 Protein Vector (Rat) (pPB-N-His) |
|
PV274699 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) ING2 Protein Vector (Rat) (pPM-C-HA) |
|
PV274700 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) ING2 Protein Vector (Rat) (pPM-C-His) |
|
PV274701 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) ING2 Protein Vector (Mouse) (pPB-C-His) |
|
PV191774 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) ING2 Protein Vector (Mouse) (pPB-N-His) |
|
PV191775 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) ING2 Protein Vector (Mouse) (pPM-C-HA) |
|
PV191776 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) ING2 Protein Vector (Mouse) (pPM-C-His) |
|
PV191777 |
ABM |
500 ng |
EUR 603 |
 Ing2 3'UTR Luciferase Stable Cell Line |
|
TU206292 |
ABM |
1.0 ml |
Ask for price |
 Ing2 3'UTR GFP Stable Cell Line |
|
TU160117 |
ABM |
1.0 ml |
Ask for price |
 ING2 3'UTR Luciferase Stable Cell Line |
|
TU011155 |
ABM |
1.0 ml |
EUR 1394 |
Ing2 3'UTR Luciferase Stable Cell Line |
|
TU110117 |
ABM |
1.0 ml |
Ask for price |
 ING2 3'UTR GFP Stable Cell Line |
|
TU061155 |
ABM |
1.0 ml |
EUR 1394 |
Ing2 3'UTR GFP Stable Cell Line |
|
TU256292 |
ABM |
1.0 ml |
Ask for price |
 (CMV) (pLenti-GIII-CMV)) ING2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV621805 |
ABM |
1.0 ug DNA |
EUR 514 |
 (UbC) (pLenti-GIII-UbC)) ING2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV621809 |
ABM |
1.0 ug DNA |
EUR 514 |
 (EF1a) (pLenti-GIII-EF1a)) ING2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV621810 |
ABM |
1.0 ug DNA |
EUR 514 |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
|
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG13 Rabbit Polyclonal Antibody |
|
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG14L Rabbit Polyclonal Antibody |
|
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
|
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NBR1 Rabbit Polyclonal Antibody |
|
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Gab1 Rabbit Polyclonal Antibody |
|
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
|
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ERK1 Rabbit Polyclonal Antibody |
|
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
|
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ING2 Rabbit Polyclonal Antibody
