ING3 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

ING3 Polyclonal Antibody
ABP58939-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human ING3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ING3 from Human, Mouse, Rat. This ING3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ING3 protein
ING3 Polyclonal Antibody
ABP58939-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ING3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ING3 from Human, Mouse, Rat. This ING3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ING3 protein
ING3 Polyclonal Antibody
ABP58939-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ING3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ING3 from Human, Mouse, Rat. This ING3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ING3 protein
ING3 Polyclonal Antibody
ES10794-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ING3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
ING3 Polyclonal Antibody
ES10794-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ING3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
ING3 Rabbit pAb
A5832-100ul 100 ul
EUR 308
ING3 Rabbit pAb
A5832-200ul 200 ul
EUR 459
ING3 Rabbit pAb
A5832-20ul 20 ul
EUR 183
ING3 Rabbit pAb
A5832-50ul 50 ul
EUR 223
ING3 antibody
70R-17970 50 ul
EUR 435
Description: Rabbit polyclonal ING3 antibody
ING3 antibody
70R-2097 50 ug
EUR 467
Description: Rabbit polyclonal ING3 antibody raised against the N terminal of ING3
ING3 antibody
70R-3052 50 ug
EUR 467
Description: Rabbit polyclonal ING3 antibody raised against the middle region of ING3
ING3 Antibody
33074-100ul 100ul
EUR 252
ING3 Antibody
1-CSB-PA865171LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ING3. Recognizes ING3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:2000-1:10000, IHC:1:20-1:200
ING3 Antibody
DF2637 200ul
EUR 304
Description: ING3 antibody detects endogenous levels of total ING3.
ING3 Antibody
DF8079 200ul
EUR 304
Description: ING3 Antibody detects endogenous levels of total ING3.
ING3 Antibody
1-CSB-PA011714GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ING3. Recognizes ING3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC
ING3 Antibody
ABD2637 100 ug
EUR 438
ING3 Antibody
ABD8079 100 ug
EUR 438
ING3 Conjugated Antibody
C33074 100ul
EUR 397
ING3-specific Antibody
abx234312-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
anti- ING3 antibody
FNab04311 100µg
EUR 548.75
  • Immunogen: inhibitor of growth family, member 3
  • Uniprot ID: Q9NXR8
  • Gene ID: 54556
  • Research Area: Cancer, Metabolism
Description: Antibody raised against ING3
Anti-ING3 antibody
PAab04311 100 ug
EUR 386
Anti-ING3 antibody
STJ28395 100 µl
EUR 277
Description: The protein encoded by this gene is similar to ING1, a tumor suppressor protein that can interact with TP53, inhibit cell growth, and induce apoptosis. This protein contains a PHD-finger, which is a common motif in proteins involved in chromatin remodeling. This gene can activate p53 trans-activated promoters, including promoters of p21/waf1 and bax. Overexpression of this gene has been shown to inhibit cell growth and induce apoptosis. Allelic loss and reduced expression of this gene were detected in head and neck cancers. Two alternatively spliced transcript variants encoding different isoforms have been observed.
Anti-ING3 antibody
STJ191952 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ING3
Ing3/ Rat Ing3 ELISA Kit
ELI-37703r 96 Tests
EUR 886
ING3 siRNA
20-abx902680
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ING3 siRNA
20-abx920607
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ING3 siRNA
20-abx920608
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-ING3
YF-PA26262 50 ul
EUR 334
Description: Mouse polyclonal to ING3
Anti-p47 ING3 Antibody
A05458 100ug
EUR 432
Description: Goat Polyclonal p47 ING3 Antibody. Validated in WB and tested in Human.
ING3 Antibody, HRP conjugated
1-CSB-PA865171LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ING3. Recognizes ING3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
ING3 Antibody, FITC conjugated
1-CSB-PA865171LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ING3. Recognizes ING3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
ING3 Antibody, Biotin conjugated
1-CSB-PA865171LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ING3. Recognizes ING3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
anti- ING3-specific antibody
FNab04312 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2400
  • Immunogen: inhibitor of growth family, member 3
  • Uniprot ID: Q9NXR8
  • Research Area: Cancer, Metabolism
Description: Antibody raised against ING3-specific
Anti-ING3-specific antibody
PAab04312 100 ug
EUR 386
ING3 Blocking Peptide
33R-5453 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ING3 antibody, catalog no. 70R-3052
ING3 Blocking Peptide
33R-5862 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ING3 antibody, catalog no. 70R-2097
ING3 Blocking Peptide
DF2637-BP 1mg
EUR 195
ING3 Blocking Peptide
DF8079-BP 1mg
EUR 195
ING3 cloning plasmid
CSB-CL865171HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 279
  • Sequence: atgttgtacctagaagactatctggaaatgattgagcagcttcctatggatctgcgggaccgcttcacggaaatgcgcgagatggacctgcaggtgcagaatgcaatggatcaactagaacaaagagtcagtgaattctttatgaatgcaaagaaaaataaacctgagtggaggga
  • Show more
Description: A cloning plasmid for the ING3 gene.
ING3 cloning plasmid
CSB-CL865171HU2-10ug 10ug
EUR 194
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 300
  • Sequence: atgttgtacctagaagactatctggaaatgattgagcagcttcctatggatctgcgggaccgcttcacggaaatgcgcgagatggacctgcaggtgcagaatgcaatggatcaactagaacaaagagtcagtgaattctttatgaatgcaaagaaaaataaacctgagtggaggga
  • Show more
Description: A cloning plasmid for the ING3 gene.
ING3 cloning plasmid
CSB-CL865171HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 282
  • Sequence: atgttgtacctagaagactatctggaaatgattgagcagcttcctatggatctgcgggaccgcttcacggaaatgcgcgagatggacctgcaggtgcagaatgcaatggatcaactagaacaaagagtcagtgaattctttatgaatgcaaagaaaaataaacctgagtggaggga
  • Show more
Description: A cloning plasmid for the ING3 gene.
Anti-ING3 (2E9)
YF-MA18657 50 ug
EUR 363
Description: Mouse monoclonal to ING3
Anti-ING3 (2C4)
YF-MA18659 100 ug
EUR 363
Description: Mouse monoclonal to ING3
Anti-ING3 (2D8)
YF-MA18660 100 ug
EUR 363
Description: Mouse monoclonal to ING3
ING3 ELISA KIT|Human
EF010338 96 Tests
EUR 689
Rat ING3 shRNA Plasmid
20-abx989707
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse ING3 shRNA Plasmid
20-abx977509
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human ING3 shRNA Plasmid
20-abx960134
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ING3 Recombinant Protein (Human)
RP016144 100 ug Ask for price
ING3 Recombinant Protein (Human)
RP016147 100 ug Ask for price
ING3 Recombinant Protein (Human)
RP016150 100 ug Ask for price
ING3 Recombinant Protein (Rat)
RP206024 100 ug Ask for price
ING3 Recombinant Protein (Mouse)
RP143831 100 ug Ask for price
Inhibitor of Growth Protein 3 (ING3) Antibody
20-abx004471
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Inhibitor of Growth Protein 3 (ING3) Antibody
20-abx113134
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Inhibitor of Growth Protein 3 (ING3) Antibody
abx146142-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Inhibitor of Growth Protein 3 (ING3) Antibody
abx234311-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Inhibitor of Growth Protein 3 (ING3) Antibody
20-abx317940
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Inhibitor of Growth Protein 3 (ING3) Antibody
20-abx225249
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ing3 ORF Vector (Rat) (pORF)
ORF068676 1.0 ug DNA
EUR 506
ING3 ORF Vector (Human) (pORF)
ORF005382 1.0 ug DNA
EUR 95
ING3 ORF Vector (Human) (pORF)
ORF005383 1.0 ug DNA
EUR 95
ING3 ORF Vector (Human) (pORF)
ORF005384 1.0 ug DNA
EUR 95
Ing3 ORF Vector (Mouse) (pORF)
ORF047945 1.0 ug DNA
EUR 506
Inhibitor of Growth Protein 3 (ING3) Antibody (HRP)
20-abx314653
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Inhibitor of Growth Protein 3 (ING3) Antibody (FITC)
20-abx314654
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Inhibitor of Growth Protein 3 (ING3) Antibody (Biotin)
20-abx314655
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ing3 sgRNA CRISPR Lentivector set (Rat)
K7326601 3 x 1.0 ug
EUR 339
Ing3 sgRNA CRISPR Lentivector set (Mouse)
K4032601 3 x 1.0 ug
EUR 339
ING3 sgRNA CRISPR Lentivector set (Human)
K1087901 3 x 1.0 ug
EUR 339
Ing3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7326602 1.0 ug DNA
EUR 154
Ing3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7326603 1.0 ug DNA
EUR 154
Ing3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7326604 1.0 ug DNA
EUR 154
Ing3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4032602 1.0 ug DNA
EUR 154
Ing3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4032603 1.0 ug DNA
EUR 154
Ing3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4032604 1.0 ug DNA
EUR 154
ING3 sgRNA CRISPR Lentivector (Human) (Target 1)
K1087902 1.0 ug DNA
EUR 154
ING3 sgRNA CRISPR Lentivector (Human) (Target 2)
K1087903 1.0 ug DNA
EUR 154
ING3 sgRNA CRISPR Lentivector (Human) (Target 3)
K1087904 1.0 ug DNA
EUR 154
ING3 Protein Vector (Human) (pPB-C-His)
PV021525 500 ng
EUR 329
ING3 Protein Vector (Human) (pPB-N-His)
PV021526 500 ng
EUR 329
ING3 Protein Vector (Human) (pPM-C-HA)
PV021527 500 ng
EUR 329
ING3 Protein Vector (Human) (pPM-C-His)
PV021528 500 ng
EUR 329
ING3 Protein Vector (Human) (pPB-C-His)
PV021529 500 ng
EUR 329
ING3 Protein Vector (Human) (pPB-N-His)
PV021530 500 ng
EUR 329
ING3 Protein Vector (Human) (pPM-C-HA)
PV021531 500 ng
EUR 329
ING3 Protein Vector (Human) (pPM-C-His)
PV021532 500 ng
EUR 329
ING3 Protein Vector (Human) (pPB-C-His)
PV021533 500 ng
EUR 329
ING3 Protein Vector (Human) (pPB-N-His)
PV021534 500 ng
EUR 329
ING3 Protein Vector (Human) (pPM-C-HA)
PV021535 500 ng
EUR 329
ING3 Protein Vector (Human) (pPM-C-His)
PV021536 500 ng
EUR 329
ING3 Protein Vector (Rat) (pPB-C-His)
PV274702 500 ng
EUR 603
ING3 Protein Vector (Rat) (pPB-N-His)
PV274703 500 ng
EUR 603
ING3 Protein Vector (Rat) (pPM-C-HA)
PV274704 500 ng
EUR 603
ING3 Protein Vector (Rat) (pPM-C-His)
PV274705 500 ng
EUR 603
ING3 Protein Vector (Mouse) (pPB-C-His)
PV191778 500 ng
EUR 603
ING3 Protein Vector (Mouse) (pPB-N-His)
PV191779 500 ng
EUR 603
ING3 Protein Vector (Mouse) (pPM-C-HA)
PV191780 500 ng
EUR 603
ING3 Protein Vector (Mouse) (pPM-C-His)
PV191781 500 ng
EUR 603
Ing3 3'UTR Luciferase Stable Cell Line
TU110118 1.0 ml Ask for price
Ing3 3'UTR GFP Stable Cell Line
TU160118 1.0 ml Ask for price
Ing3 3'UTR Luciferase Stable Cell Line
TU206293 1.0 ml Ask for price
Ing3 3'UTR GFP Stable Cell Line
TU256293 1.0 ml Ask for price
ING3 3'UTR GFP Stable Cell Line
TU061156 1.0 ml
EUR 2333
ING3 3'UTR Luciferase Stable Cell Line
TU011156 1.0 ml
EUR 2333
ING3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV711459 1.0 ug DNA
EUR 316
ING3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV711463 1.0 ug DNA
EUR 316
ING3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV711464 1.0 ug DNA
EUR 316
ING3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV711465 1.0 ug DNA
EUR 316
ING3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV711469 1.0 ug DNA
EUR 316
ING3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV711470 1.0 ug DNA
EUR 316
ING3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV681787 1.0 ug DNA
EUR 682
ING3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV681791 1.0 ug DNA
EUR 682
ING3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV681792 1.0 ug DNA
EUR 682
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187
EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252
EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187
Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252
Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187
LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252
LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187
GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

ING3 Rabbit Polyclonal Antibody