KRT86 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

KRT86 Polyclonal Antibody
ABP59084-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human KRT86 protein
  • Applications tips:
Description: A polyclonal antibody for detection of KRT86 from Human. This KRT86 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KRT86 protein
KRT86 Polyclonal Antibody
ABP59084-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human KRT86 protein
  • Applications tips:
Description: A polyclonal antibody for detection of KRT86 from Human. This KRT86 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KRT86 protein
KRT86 Polyclonal Antibody
ES10729-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against KRT86 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
KRT86 Polyclonal Antibody
ES10729-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against KRT86 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
Polyclonal KRT86 Antibody (Center)
APR17130G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KRT86 (Center). This antibody is tested and proven to work in the following applications:
Anti-KRT86 antibody
STJ191887 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to KRT86
KRT86 siRNA
20-abx922042
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
KRT86 siRNA
20-abx922043
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
KRT86 cloning plasmid
CSB-CL012581HU-10ug 10ug
EUR 518
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1461
  • Sequence: atgacttgtggatcttactgtggtggccgcgccttcagctgcatctcggcctgcgggccccggcccggccgctgctgcatcaccgccgccccctaccgtggcatctcctgctaccgcggcctcaccgggggcttcggcagccacagcgtgtgcggaggctttcgggccggctcct
  • Show more
Description: A cloning plasmid for the KRT86 gene.
Human KRT86 shRNA Plasmid
20-abx952638
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse KRT86 shRNA Plasmid
20-abx971249
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
KRT86 Recombinant Protein (Human)
RP017407 100 ug Ask for price
KRT86 Recombinant Protein (Rat)
RP207677 100 ug Ask for price
KRT86 Recombinant Protein (Mouse)
RP146540 100 ug Ask for price
Keratin, Type II Cuticular Hb6 (KRT86) Antibody
abx145907-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Keratin, Type II Cuticular Hb6 (KRT86) Antibody
abx031387-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Keratin, Type II Cuticular Hb6 (KRT86) Antibody
abx031387-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Krt86 ORF Vector (Rat) (pORF)
ORF069227 1.0 ug DNA
EUR 506
KRT86 ORF Vector (Human) (pORF)
ORF005803 1.0 ug DNA
EUR 95
Krt86 ORF Vector (Mouse) (pORF)
ORF048848 1.0 ug DNA
EUR 506
Krt86 sgRNA CRISPR Lentivector set (Rat)
K6730601 3 x 1.0 ug
EUR 339
Krt86 sgRNA CRISPR Lentivector set (Mouse)
K3250901 3 x 1.0 ug
EUR 339
KRT86 sgRNA CRISPR Lentivector set (Human)
K1179201 3 x 1.0 ug
EUR 339
Krt86 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6730602 1.0 ug DNA
EUR 154
Krt86 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6730603 1.0 ug DNA
EUR 154
Krt86 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6730604 1.0 ug DNA
EUR 154
Krt86 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3250902 1.0 ug DNA
EUR 154
Krt86 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3250903 1.0 ug DNA
EUR 154
Krt86 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3250904 1.0 ug DNA
EUR 154
KRT86 sgRNA CRISPR Lentivector (Human) (Target 1)
K1179202 1.0 ug DNA
EUR 154
KRT86 sgRNA CRISPR Lentivector (Human) (Target 2)
K1179203 1.0 ug DNA
EUR 154
KRT86 sgRNA CRISPR Lentivector (Human) (Target 3)
K1179204 1.0 ug DNA
EUR 154
KRT86 Protein Vector (Human) (pPB-C-His)
PV023209 500 ng
EUR 329
KRT86 Protein Vector (Human) (pPB-N-His)
PV023210 500 ng
EUR 329
KRT86 Protein Vector (Human) (pPM-C-HA)
PV023211 500 ng
EUR 329
KRT86 Protein Vector (Human) (pPM-C-His)
PV023212 500 ng
EUR 329
KRT86 Protein Vector (Rat) (pPB-C-His)
PV276906 500 ng
EUR 603
KRT86 Protein Vector (Rat) (pPB-N-His)
PV276907 500 ng
EUR 603
KRT86 Protein Vector (Rat) (pPM-C-HA)
PV276908 500 ng
EUR 603
KRT86 Protein Vector (Rat) (pPM-C-His)
PV276909 500 ng
EUR 603
KRT86 Protein Vector (Mouse) (pPB-C-His)
PV195390 500 ng
EUR 603
KRT86 Protein Vector (Mouse) (pPB-N-His)
PV195391 500 ng
EUR 603
KRT86 Protein Vector (Mouse) (pPM-C-HA)
PV195392 500 ng
EUR 603
KRT86 Protein Vector (Mouse) (pPM-C-His)
PV195393 500 ng
EUR 603
Krt86 3'UTR Luciferase Stable Cell Line
TU110798 1.0 ml Ask for price
Krt86 3'UTR GFP Stable Cell Line
TU160798 1.0 ml Ask for price
Krt86 3'UTR Luciferase Stable Cell Line
TU206888 1.0 ml Ask for price
Krt86 3'UTR GFP Stable Cell Line
TU256888 1.0 ml Ask for price
KRT86 3'UTR GFP Stable Cell Line
TU062093 1.0 ml
EUR 1394
KRT86 3'UTR Luciferase Stable Cell Line
TU012093 1.0 ml
EUR 1394
KRT86 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV624091 1.0 ug DNA
EUR 682
KRT86 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV624095 1.0 ug DNA
EUR 682
KRT86 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV624096 1.0 ug DNA
EUR 682
Mouse Keratin, type II cuticular Hb6, Krt86 ELISA KIT
ELI-14436m 96 Tests
EUR 865
Human Keratin, type II cuticular Hb6, KRT86 ELISA KIT
ELI-15910h 96 Tests
EUR 824
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187
EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252
EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187
Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252
Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187
LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252
LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187
GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

KRT86 Rabbit Polyclonal Antibody