MUL1 Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
MUL1 Polyclonal Antibody |
ABP59346-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human MUL1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of MUL1 from Human, Mouse. This MUL1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MUL1 protein |
MUL1 Polyclonal Antibody |
ABP59346-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human MUL1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of MUL1 from Human, Mouse. This MUL1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MUL1 protein |
MUL1 Rabbit pAb |
A13125-100ul |
Abclonal |
100 ul |
EUR 308 |
MUL1 Rabbit pAb |
A13125-200ul |
Abclonal |
200 ul |
EUR 459 |
MUL1 Rabbit pAb |
A13125-20ul |
Abclonal |
20 ul |
EUR 183 |
MUL1 Rabbit pAb |
A13125-50ul |
Abclonal |
50 ul |
EUR 223 |
MUL1 Rabbit pAb |
A9164-100ul |
Abclonal |
100 ul |
EUR 308 |
MUL1 Rabbit pAb |
A9164-200ul |
Abclonal |
200 ul |
EUR 459 |
MUL1 Rabbit pAb |
A9164-20ul |
Abclonal |
20 ul |
Ask for price |
MUL1 Rabbit pAb |
A9164-50ul |
Abclonal |
50 ul |
Ask for price |
Polyclonal MUL1 Antibody (Center) |
APR08576G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MUL1 (Center). This antibody is tested and proven to work in the following applications: |
MUL1 Antibody |
44855-100ul |
SAB |
100ul |
EUR 252 |
MUL1 Antibody |
44855-50ul |
SAB |
50ul |
EUR 187 |
MUL1 antibody |
70R-18680 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal MUL1 antibody |
MUL1 Antibody |
DF2589 |
Affbiotech |
200ul |
EUR 304 |
Description: MUL1 antibody detects endogenous levels of total MUL1. |
MUL1 Antibody |
1-CSB-PA015235GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against MUL1. Recognizes MUL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC |
Polyclonal MUL1 Antibody (C-term) |
APR08575G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MUL1 (C-term). This antibody is tested and proven to work in the following applications: |
MUL1 Conjugated Antibody |
C44855 |
SAB |
100ul |
EUR 397 |
anti- MUL1 antibody |
FNab05435 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: mitochondrial E3 ubiquitin ligase 1
- Uniprot ID: Q969V5
- Gene ID: 79594
- Research Area: Epigenetics, Signal Transduction, Metabolism
|
Description: Antibody raised against MUL1 |
Anti-MUL1 antibody |
STJ191920 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to MUL1 |
MUL1 siRNA |
20-abx925035 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MUL1 siRNA |
20-abx925036 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MUL1 Blocking Peptide |
DF2589-BP |
Affbiotech |
1mg |
EUR 195 |
MUL1 cloning plasmid |
CSB-CL839281HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1059
- Sequence: atggagagcggagggcggccctcgctgtgccagttcatcctcctgggcaccacctctgtggtcaccgccgccctgtactccgtgtaccggcagaaggcccgggtctcccaagagctcaagggagctaaaaaagttcatttgggtgaagatttaaagagtattctttcagaagctc
- Show more
|
Description: A cloning plasmid for the MUL1 gene. |
Mouse MUL1 shRNA Plasmid |
20-abx976594 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human MUL1 shRNA Plasmid |
20-abx962413 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
MUL1 Recombinant Protein (Human) |
RP020398 |
ABM |
100 ug |
Ask for price |
MUL1 Recombinant Protein (Rat) |
RP212789 |
ABM |
100 ug |
Ask for price |
MUL1 Recombinant Protein (Mouse) |
RP152270 |
ABM |
100 ug |
Ask for price |
MUL1 ORF Vector (Human) (pORF) |
ORF006800 |
ABM |
1.0 ug DNA |
EUR 95 |
Mul1 ORF Vector (Mouse) (pORF) |
ORF050758 |
ABM |
1.0 ug DNA |
EUR 506 |
Mul1 ORF Vector (Rat) (pORF) |
ORF070931 |
ABM |
1.0 ug DNA |
EUR 506 |
MUL1 ELISA Kit (Human) (OKWB00235) |
OKWB00235 |
Aviva Systems Biology |
96 Wells |
EUR 572 |
Description: Description of target: Exhibits weak E3 ubiquitin-protein ligase activity. E3 ubiquitin ligases accept ubiquitin from an E2 ubiquitin-conjugating enzyme in the form of a thioester and then directly transfer the ubiquitin to targeted substrates. Can ubiquitinate AKT1 preferentially at 'Lys-284' involving 'Lys-48'-linked polyubiquitination and seems to be involved in regulation of Akt signaling by targeting phosphorylated Akt to proteosomal degradation. Proposed to preferentially act as a SUMO E3 ligase at physiological concentrations. Plays a role in the control of mitochondrial morphology. Promotes mitochondrial fragmentation and influences mitochondrial localization. The function may implicate its ability to sumoylate DNM1L. Inhibits cell growth. When overexpressed, activates JNK through MAP3K7/TAK1 and induces caspase-dependent apoptosis. Involved in the modulation of innate immune defense against viruses by inhibiting DDX58-dependent antiviral response. Can mediate DDX58 sumoylation and disrupt its polyubiquitination.;Species reactivity: Human;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL |
MUL1 sgRNA CRISPR Lentivector set (Human) |
K1368501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Mul1 sgRNA CRISPR Lentivector set (Mouse) |
K3239701 |
ABM |
3 x 1.0 ug |
EUR 339 |
anti-E3 ubiquitin-protein ligase MUL1 |
YF-PA26608 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to E3 ubiquitin-protein ligase MUL1 |
Mitochondrial Ubiquitin Ligase Activator of NFKB 1 (MUL1) Antibody |
20-abx124782 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Mitochondrial Ubiquitin Ligase Activator of NFKB 1 (MUL1) Antibody |
20-abx147625 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Mitochondrial Ubiquitin Ligase Activator of NFKB 1 (MUL1) Antibody |
abx027028-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Mitochondrial Ubiquitin Ligase Activator of NFKB 1 (MUL1) Antibody |
abx027028-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Mitochondrial Ubiquitin Ligase Activator of NFKB 1 (MUL1) Antibody |
abx235435-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
MUL1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1368502 |
ABM |
1.0 ug DNA |
EUR 154 |
MUL1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1368503 |
ABM |
1.0 ug DNA |
EUR 154 |
MUL1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1368504 |
ABM |
1.0 ug DNA |
EUR 154 |
Mul1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3239702 |
ABM |
1.0 ug DNA |
EUR 154 |
Mul1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3239703 |
ABM |
1.0 ug DNA |
EUR 154 |
Mul1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3239704 |
ABM |
1.0 ug DNA |
EUR 154 |
MUL1 Protein Vector (Rat) (pPB-C-His) |
PV283722 |
ABM |
500 ng |
EUR 603 |
MUL1 Protein Vector (Rat) (pPB-N-His) |
PV283723 |
ABM |
500 ng |
EUR 603 |
MUL1 Protein Vector (Rat) (pPM-C-HA) |
PV283724 |
ABM |
500 ng |
EUR 603 |
MUL1 Protein Vector (Rat) (pPM-C-His) |
PV283725 |
ABM |
500 ng |
EUR 603 |
MUL1 Protein Vector (Human) (pPB-C-His) |
PV027197 |
ABM |
500 ng |
EUR 329 |
MUL1 Protein Vector (Human) (pPB-N-His) |
PV027198 |
ABM |
500 ng |
EUR 329 |
MUL1 Protein Vector (Human) (pPM-C-HA) |
PV027199 |
ABM |
500 ng |
EUR 329 |
MUL1 Protein Vector (Human) (pPM-C-His) |
PV027200 |
ABM |
500 ng |
EUR 329 |
MUL1 Protein Vector (Mouse) (pPB-C-His) |
PV203030 |
ABM |
500 ng |
EUR 603 |
MUL1 Protein Vector (Mouse) (pPB-N-His) |
PV203031 |
ABM |
500 ng |
EUR 603 |
MUL1 Protein Vector (Mouse) (pPM-C-HA) |
PV203032 |
ABM |
500 ng |
EUR 603 |
MUL1 Protein Vector (Mouse) (pPM-C-His) |
PV203033 |
ABM |
500 ng |
EUR 603 |
Mul1 3'UTR GFP Stable Cell Line |
TU163630 |
ABM |
1.0 ml |
Ask for price |
MUL1 3'UTR Luciferase Stable Cell Line |
TU014978 |
ABM |
1.0 ml |
EUR 1394 |
Mul1 3'UTR Luciferase Stable Cell Line |
TU113630 |
ABM |
1.0 ml |
Ask for price |
MUL1 3'UTR GFP Stable Cell Line |
TU064978 |
ABM |
1.0 ml |
EUR 1394 |
MUL1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV639661 |
ABM |
1.0 ug DNA |
EUR 682 |
MUL1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV639665 |
ABM |
1.0 ug DNA |
EUR 682 |
MUL1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV639666 |
ABM |
1.0 ug DNA |
EUR 682 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
MUL1 Rabbit Polyclonal Antibody