NEK2 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

NEK2 Polyclonal Antibody

ES10816-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NEK2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

NEK2 Polyclonal Antibody

ES10816-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NEK2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

NEK2 Rabbit pAb

A13334-100ul 100 ul
EUR 308

NEK2 Rabbit pAb

A13334-200ul 200 ul
EUR 459

NEK2 Rabbit pAb

A13334-20ul 20 ul
EUR 183

NEK2 Rabbit pAb

A13334-50ul 50 ul
EUR 223

NEK2 Rabbit pAb

A5355-100ul 100 ul
EUR 308

NEK2 Rabbit pAb

A5355-200ul 200 ul
EUR 459

NEK2 Rabbit pAb

A5355-20ul 20 ul
EUR 183

NEK2 Rabbit pAb

A5355-50ul 50 ul
EUR 223

Polyclonal NEK2 Antibody (Center)

APR06062G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NEK2 (Center). This antibody is tested and proven to work in the following applications:

NEK2 antibody

70R-18839 50 ul
EUR 435
Description: Rabbit polyclonal NEK2 antibody

NEK2 Antibody

32795-100ul 100ul
EUR 252

NEK2 Antibody

DF2669 200ul
EUR 304
Description: NEK2 antibody detects endogenous levels of total NEK2.

NEK2 Antibody

DF7296 200ul
EUR 304
Description: NEK2 Antibody detects endogenous levels of total NEK2.

NEK2 Antibody

1-CSB-PA295415
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NEK2. Recognizes NEK2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

NEK2 Antibody

1-CSB-PA015699ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NEK2. Recognizes NEK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

NEK2 Antibody

1-CSB-PA015699GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NEK2. Recognizes NEK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

NEK2 Antibody

AF7557 200ul
EUR 376
Description: NEK2 Antibody detects endogenous levels of NEK2.

NEK2 Antibody

ABD2669 100 ug
EUR 438

NEK2 Antibody

ABD7296 100 ug
EUR 438

Polyclonal NEK2 Antibody (aa287-299)

APR02189G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NEK2 (aa287-299). This antibody is tested and proven to work in the following applications:

Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody

abx025140-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody

abx025140-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody

20-abx004096
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody

20-abx213477
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody

abx146251-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody

20-abx142097
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody

abx033852-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody

abx033852-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody

20-abx320236
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody

abx235651-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Serine, Threonine-Protein Kinase Nek2 (NEK2) Antibody

abx235652-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

NEK2 (Phospho-Ser170) Polyclonal Conjugated Antibody

C12922 100ul
EUR 397

Anti-NEK2 Antibody

A01606 100ug
EUR 432
Description: Rabbit Polyclonal NEK2 Antibody. Validated in WB and tested in Human.

NEK2 Conjugated Antibody

C32795 100ul
EUR 397

anti- NEK2 antibody

FNab05651 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: NIMA (never in mitosis gene a)-related kinase 2
  • Uniprot ID: P51955
  • Gene ID: 4751
  • Research Area: Metabolism
Description: Antibody raised against NEK2

anti- NEK2 antibody

FNab05652 100µg
EUR 548.75
  • Immunogen: NIMA(never in mitosis gene a)-related kinase 2
  • Uniprot ID: P51955
  • Research Area: Metabolism
Description: Antibody raised against NEK2

Anti-NEK2 antibody

PAab05651 100 ug
EUR 386

Anti-NEK2 antibody

PAab05652 100 ug
EUR 386

Anti-NEK2 antibody

STJ27308 100 µl
EUR 277
Description: This gene encodes a serine/threonine-protein kinase that is involved in mitotic regulation. This protein is localized to the centrosome, and undetectable during G1 phase, but accumulates progressively throughout the S phase, reaching maximal levels in late G2 phase. Alternatively spliced transcript variants encoding different isoforms with distinct C-termini have been noted for this gene.

Anti-NEK2 antibody

STJ115297 100 µl
EUR 277
Description: This gene encodes a serine/threonine-protein kinase that is involved in mitotic regulation. This protein is localized to the centrosome, and undetectable during G1 phase, but accumulates progressively throughout the S phase, reaching maximal levels in late G2 phase. Alternatively spliced transcript variants encoding different isoforms with distinct C-termini have been noted for this gene.

Anti-NEK2 antibody

STJ191974 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NEK2

NEK2 protein

30R-2834 5 ug
EUR 503
Description: Purified recombinant Human NEK2 protein

NEK2, Active

7719-5
EUR 370

NEK2 siRNA

20-abx925714
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NEK2 siRNA

20-abx925715
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-NEK2

YF-PA13411 50 ul
EUR 363
Description: Mouse polyclonal to NEK2

anti-NEK2

YF-PA13412 50 ug
EUR 363
Description: Mouse polyclonal to NEK2

anti-NEK2

YF-PA13413 100 ul
EUR 403
Description: Rabbit polyclonal to NEK2

anti-NEK2

YF-PA13414 100 ug
EUR 403
Description: Rabbit polyclonal to NEK2

NEK2 (Phospho-Ser170) Antibody

12922-100ul 100ul
EUR 252

NEK2 (Phospho-Ser170) Antibody

12922-50ul 50ul
EUR 187

Phospho-NEK2(Ser170) Antibody

AF7057 200ul
EUR 376
Description: Phospho-NEK2(Ser170) Antibody detects endogenous levels of NEK2 only when phosphorylated at Ser170.

NEK2 Blocking Peptide

DF2669-BP 1mg
EUR 195

NEK2 Blocking Peptide

DF7296-BP 1mg
EUR 195

NEK2 Blocking Peptide

AF7557-BP 1mg
EUR 195

NEK2 cloning plasmid

CSB-CL015699HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 645
  • Sequence: atgccttcccgggctgaggactatgaagtgttgtacaccattggcacaggctcctacggccgctgccagaagatccggaggaagagtgatggcaagatattagtttggaaagaacttgactatggctccatgacagaagctgagaaacagatgcttgtttctgaagtgaatttgct
  • Show more
Description: A cloning plasmid for the NEK2 gene.

Anti-NEK2 (2F6)

YF-MA10616 100 ug
EUR 363
Description: Mouse monoclonal to NEK2

Anti-NEK2 (2F9)

YF-MA14408 100 ug
EUR 363
Description: Mouse monoclonal to NEK2

Anti-NEK2 (2A10)

YF-MA14409 100 ug
EUR 363
Description: Mouse monoclonal to NEK2

Anti-NEK2 (1C8)

YF-MA14410 100 ug
EUR 363
Description: Mouse monoclonal to NEK2

Anti-NEK2 (3B7)

YF-MA14411 100 ug
EUR 363
Description: Mouse monoclonal to NEK2

Human Serine, threonine-protein kinase Nek2 (NEK2) ELISA Kit

abx257267-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Human NEK2(Serine/threonine-protein kinase Nek2) ELISA Kit

EH4130 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P51955
  • Alias: HSPK 21/Never in mitosis A-related kinase 2/NimA-related protein kinase 2/NimA-like protein kinase 1/NEK2A/NLK1
Description: Method of detection: Sandwich ELISA, Double Antigen;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Mouse Serine/threonine- protein kinase Nek2, Nek2 ELISA KIT

ELI-42481m 96 Tests
EUR 865

Human Serine/threonine- protein kinase Nek2, NEK2 ELISA KIT

ELI-36500h 96 Tests
EUR 824

NEK2 ELISA KIT|Human

EF007336 96 Tests
EUR 689

Mouse NEK2 shRNA Plasmid

20-abx971710
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NEK2 shRNA Plasmid

20-abx953154
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Monoclonal NEK2 Antibody (clone 2F6), Clone: 2F6

AMM02013G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human NEK2 (clone 2F6). The antibodies are raised in Mouse and are from clone 2F6. This antibody is applicable in WB and IHC-P, E, IP

Monoclonal NEK2 Antibody (monoclonal) (M02), Clone: 2F9

AMM03848G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human NEK2 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 2F9. This antibody is applicable in WB and IF, E

Monoclonal NEK2 Antibody (monoclonal) (M11), Clone: 3B7

AMM03849G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human NEK2 (monoclonal) (M11). The antibodies are raised in mouse and are from clone 3B7. This antibody is applicable in WB and IF

Phospho-NEK2(Ser170) Blocking Peptide

AF7057-BP 1mg
EUR 195

Nek2 ORF Vector (Rat) (pORF)

ORF071223 1.0 ug DNA
EUR 506

NEK2 ORF Vector (Human) (pORF)

ORF007021 1.0 ug DNA
EUR 95

Nek2 ORF Vector (Mouse) (pORF)

ORF051217 1.0 ug DNA
EUR 506

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human)

4-PAH562Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Lys125~Asn393)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Never In Mitosis Gene A Related Kinase 2 (NEK2)

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Rat)

4-PAH562Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Val137~Glu400)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Never In Mitosis Gene A Related Kinase 2 (NEK2)

Nek2 sgRNA CRISPR Lentivector set (Rat)

K7102501 3 x 1.0 ug
EUR 339

Nek2 sgRNA CRISPR Lentivector set (Mouse)

K3830001 3 x 1.0 ug
EUR 339

NEK2 sgRNA CRISPR Lentivector set (Human)

K1416301 3 x 1.0 ug
EUR 339

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human), APC

4-PAH562Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Lys125~Asn393)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with APC.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human), Biotinylated

4-PAH562Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Lys125~Asn393)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with Biotin.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human), Cy3

4-PAH562Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Lys125~Asn393)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with Cy3.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human), FITC

4-PAH562Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Lys125~Asn393)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with FITC.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human), HRP

4-PAH562Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Lys125~Asn393)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with HRP.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human), PE

4-PAH562Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Lys125~Asn393)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with PE.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Rat), APC

4-PAH562Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Val137~Glu400)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with APC.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Rat), Biotinylated

4-PAH562Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Val137~Glu400)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with Biotin.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Rat), Cy3

4-PAH562Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Val137~Glu400)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with Cy3.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Rat), FITC

4-PAH562Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Val137~Glu400)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with FITC.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Rat), HRP

4-PAH562Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Val137~Glu400)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with HRP.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Rat), PE

4-PAH562Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Val137~Glu400)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with PE.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human), APC-Cy7

4-PAH562Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Lys125~Asn393)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with APC-Cy7.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human, Mouse, Rat)

4-PAH562Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Phe148~Glu397)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Never In Mitosis Gene A Related Kinase 2 (NEK2)

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Rat), APC-Cy7

4-PAH562Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Val137~Glu400)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with APC-Cy7.

Nek2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7102502 1.0 ug DNA
EUR 154

Nek2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7102503 1.0 ug DNA
EUR 154

Nek2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7102504 1.0 ug DNA
EUR 154

Nek2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3830002 1.0 ug DNA
EUR 154

Nek2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3830003 1.0 ug DNA
EUR 154

Nek2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3830004 1.0 ug DNA
EUR 154

NEK2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1416302 1.0 ug DNA
EUR 154

NEK2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1416303 1.0 ug DNA
EUR 154

NEK2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1416304 1.0 ug DNA
EUR 154

NEK2 Protein Vector (Mouse) (pPB-C-His)

PV204866 500 ng
EUR 603

NEK2 Protein Vector (Mouse) (pPB-N-His)

PV204867 500 ng
EUR 603

NEK2 Protein Vector (Mouse) (pPM-C-HA)

PV204868 500 ng
EUR 603

NEK2 Protein Vector (Mouse) (pPM-C-His)

PV204869 500 ng
EUR 603

NEK2 Protein Vector (Rat) (pPB-C-His)

PV284890 500 ng
EUR 603

NEK2 Protein Vector (Rat) (pPB-N-His)

PV284891 500 ng
EUR 603

NEK2 Protein Vector (Rat) (pPM-C-HA)

PV284892 500 ng
EUR 603

NEK2 Protein Vector (Rat) (pPM-C-His)

PV284893 500 ng
EUR 603

NEK2 Protein Vector (Human) (pPB-C-His)

PV028081 500 ng
EUR 329

NEK2 Protein Vector (Human) (pPB-N-His)

PV028082 500 ng
EUR 329

NEK2 Protein Vector (Human) (pPM-C-HA)

PV028083 500 ng
EUR 329

NEK2 Protein Vector (Human) (pPM-C-His)

PV028084 500 ng
EUR 329

Nek2 3'UTR Luciferase Stable Cell Line

TU113986 1.0 ml Ask for price

Nek2 3'UTR GFP Stable Cell Line

TU163986 1.0 ml Ask for price

Nek2 3'UTR Luciferase Stable Cell Line

TU213883 1.0 ml Ask for price

Nek2 3'UTR GFP Stable Cell Line

TU263883 1.0 ml Ask for price

NEK2 3'UTR GFP Stable Cell Line

TU065566 1.0 ml
EUR 1394

NEK2 3'UTR Luciferase Stable Cell Line

TU015566 1.0 ml
EUR 1394

Never In Mitosis Gene A Related Kinase 2 (NEK2) Antibody

20-abx104136
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Antibody

20-abx104137
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Antibody

20-abx128042
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human, Mouse, Rat), APC

4-PAH562Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Phe148~Glu397)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with APC.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated

4-PAH562Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Phe148~Glu397)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with Biotin.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human, Mouse, Rat), Cy3

4-PAH562Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Phe148~Glu397)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with Cy3.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human, Mouse, Rat), FITC

4-PAH562Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Phe148~Glu397)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with FITC.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human, Mouse, Rat), HRP

4-PAH562Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Phe148~Glu397)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with HRP.

Never In Mitosis Gene A Related Kinase 2 (NEK2) Polyclonal Antibody (Human, Mouse, Rat), PE

4-PAH562Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEK2 (Phe148~Glu397)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Never In Mitosis Gene A Related Kinase 2 (NEK2). This antibody is labeled with PE.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody

ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

NEK2 Rabbit Polyclonal Antibody