PLCB1 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

PLCB1 Polyclonal Antibody
ABP59933-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PLCB1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of PLCB1 from Human, Mouse, Rat. This PLCB1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLCB1 protein
PLCB1 Polyclonal Antibody
ABP59933-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PLCB1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of PLCB1 from Human, Mouse, Rat. This PLCB1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLCB1 protein
PLCB1 Polyclonal Antibody
ES10733-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PLCB1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
PLCB1 Polyclonal Antibody
ES10733-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PLCB1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
PLCB1 Rabbit pAb
A1971-100ul 100 ul
EUR 308
PLCB1 Rabbit pAb
A1971-200ul 200 ul
EUR 459
PLCB1 Rabbit pAb
A1971-20ul 20 ul
EUR 183
PLCB1 Rabbit pAb
A1971-50ul 50 ul
EUR 223
PLCB1 Antibody
32528-100ul 100ul
EUR 252
PLCB1 Antibody
1-CSB-PA865102LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLCB1. Recognizes PLCB1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
PLCB1 Antibody
DF6726 200ul
EUR 304
Description: PLCB1 Antibody detects endogenous levels of total PLCB1.
PLCB1 Antibody
CSB-PA018126KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against PLCB1. Recognizes PLCB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200
PLCB1 Antibody
CSB-PA018126KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against PLCB1. Recognizes PLCB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200
PLCB1 antibody
70R-5669 50 ug
EUR 467
Description: Rabbit polyclonal PLCB1 antibody
PLCB1 Antibody
ABD6726 100 ug
EUR 438
PLCB1 antibody
PAab10119 100 ug
EUR 386
Polyclonal PLCB1 Antibody (C-term)
AMR09343G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLCB1 (C-term). This antibody is tested and proven to work in the following applications:
Polyclonal Plcb1 Antibody - C-terminal region
AMM07235G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Plcb1 - C-terminal region. This antibody is tested and proven to work in the following applications:
PLCB1 Conjugated Antibody
C32528 100ul
EUR 397
anti- PLCB1 antibody
FNab10119 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: phospholipase C, beta 1
  • Uniprot ID: Q9NQ66
  • Gene ID: 23236
  • Research Area: Signal Transduction
Description: Antibody raised against PLCB1
Anti-PLCB1 antibody
STJ25023 100 µl
EUR 277
Description: The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals. This gene is activated by two G-protein alpha subunits, alpha-q and alpha-11. Two transcript variants encoding different isoforms have been found for this gene.
Anti-PLCB1 antibody
STJ191891 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PLCB1
Plcb1/ Rat Plcb1 ELISA Kit
ELI-05251r 96 Tests
EUR 657
Phospholipase C beta 1 (PLCB1) polyclonal antibody
ABP-PAB-01053 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:
PLCB1 siRNA
20-abx904062
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PLCB1 siRNA
20-abx928833
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PLCB1 siRNA
20-abx928834
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
PLCB1 Antibody, HRP conjugated
1-CSB-PA865102LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLCB1. Recognizes PLCB1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
PLCB1 Antibody, FITC conjugated
1-CSB-PA865102LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLCB1. Recognizes PLCB1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
PLCB1 Antibody, Biotin conjugated
1-CSB-PA865102LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PLCB1. Recognizes PLCB1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
PLCB1 Blocking Peptide
33R-2278 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PLCB1 antibody, catalog no. 70R-5669
PLCB1 Blocking Peptide
DF6726-BP 1mg
EUR 195
PLCB1 cloning plasmid
CSB-CL865102HU1-10ug 10ug
EUR 1326
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3651
  • Sequence: atggccggggctcaacccggagtgcacgccttgcaactcaagcccgtgtgcgtgtccgacagcctcaagaagggcaccaaattcgtcaagtgggatgatgactcaactattgttactccaattattttgaggactgaccctcagggatttttcttttactggacagatcaaaaca
  • Show more
Description: A cloning plasmid for the PLCB1 gene.
PLCB1 cloning plasmid
CSB-CL865102HU2-10ug 10ug
EUR 1284
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3522
  • Sequence: atggccggggctcaacccggagtgcacgccttgcaactcaagcccgtgtgcgtgtccgacagcctcaagaagggcaccaaattcgtcaagtgggatgatgactcaactattgttactccaattattttgaggactgaccctcagggatttttcttttactggacagatcaaaaca
  • Show more
Description: A cloning plasmid for the PLCB1 gene.
Phospholipase C Beta 1 (PLCB1) Antibody
abx117174-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.
Phospholipase C Beta 1 (PLCB1) Antibody
abx034343-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Phospholipase C Beta 1 (PLCB1) Antibody
abx034343-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Phospholipase C Beta 1 (PLCB1) Antibody
20-abx302318
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Phospholipase C Beta 1 (PLCB1) Antibody
20-abx001606
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Human PLCB1 ELISA Kit
ELA-E1605h 96 Tests
EUR 824
Mouse Plcb1 ELISA KIT
ELI-05248m 96 Tests
EUR 865
Bovine PLCB1 ELISA KIT
ELI-05249b 96 Tests
EUR 928
Human PLCB1 ELISA KIT
ELI-05250h 96 Tests
EUR 824
Mouse PLCB1 shRNA Plasmid
20-abx972088
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat PLCB1 shRNA Plasmid
20-abx984582
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human PLCB1 shRNA Plasmid
20-abx958111
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Phospholipase C Beta 1 (PLCB1) Antibody (HRP)
20-abx316540
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Phospholipase C Beta 1 (PLCB1) Antibody (FITC)
20-abx316541
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Phospholipase C Beta 1 (PLCB1) Antibody (Biotin)
20-abx316542
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Anti-Phospholipase C beta 1/PLCB1 Antibody
PB9346 100ug/vial
EUR 294
Rabbit phosphatidylinositol 4,5 bisphosphate phosphodiesterase β 1(PLCB1) ELISA kit
E04P0760-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit phosphatidylinositol 4,5 bisphosphate phosphodiesterase β 1(PLCB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit phosphatidylinositol 4,5 bisphosphate phosphodiesterase β 1(PLCB1) ELISA kit
E04P0760-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit phosphatidylinositol 4,5 bisphosphate phosphodiesterase β 1(PLCB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit phosphatidylinositol 4,5 bisphosphate phosphodiesterase β 1(PLCB1) ELISA kit
E04P0760-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit phosphatidylinositol 4,5 bisphosphate phosphodiesterase β 1(PLCB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Phospholipase C Beta 1, Phosphoinositide-Specific (PLCB1) ELISA Kit
abx363285-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Plcb1 ORF Vector (Rat) (pORF)
ORF073609 1.0 ug DNA
EUR 506
PLCB1 ORF Vector (Human) (pORF)
ORF014092 1.0 ug DNA
EUR 354
PLCB1 ORF Vector (Human) (pORF)
ORF007907 1.0 ug DNA
EUR 95
Plcb1 ORF Vector (Mouse) (pORF)
ORF054210 1.0 ug DNA
EUR 506
Plcb1 ORF Vector (Mouse) (pORF)
ORF054211 1.0 ug DNA
EUR 506
PLCB1 ELISA Kit (Human) (OKEH04261)
OKEH04261 96 Wells
EUR 662
Description: Description of target: The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals. This gene is activated by two G-protein alpha subunits, alpha-q and alpha-11. Two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.045 ng/mL
PLCB1 ELISA Kit (Mouse) (OKEH05393)
OKEH05393 96 Wells
EUR 662
Description: Description of target: The production of the second messenger molecules diacylglycerol (DAG) and inositol 1,4,5-trisphosphate (IP3) is mediated by activated phosphatidylinositol-specific phospholipase C enzymes.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.16 ng/mL
PLCB1 ELISA Kit (Rat) (OKEH06133)
OKEH06133 96 Wells
EUR 662
Description: Description of target: The production of the second messenger molecules diacylglycerol (DAG) and inositol 1,4,5-trisphosphate (IP3) is mediated by activated phosphatidylinositol-specific phospholipase C enzymes. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.162 ng/mL
PLCB1 ELISA Kit (Bovine) (OKEH08391)
OKEH08391 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.08ng/mL
Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1) Antibody
20-abx131473
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Plcb1 sgRNA CRISPR Lentivector set (Rat)
K6748601 3 x 1.0 ug
EUR 339
Plcb1 sgRNA CRISPR Lentivector set (Mouse)
K3836201 3 x 1.0 ug
EUR 339
PLCB1 sgRNA CRISPR Lentivector set (Human)
K1662401 3 x 1.0 ug
EUR 339
PLCB1-IT1 ORF Vector (Human) (pORF)
ORF027934 1.0 ug DNA Ask for price
Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1) Polyclonal Antibody (Human, Mouse, Rat, Pig)
4-PAB596Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLCb1 (Glu316~Gly476)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1)
Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1) Polyclonal Antibody (Human, Mouse, Rat, Pig), APC
4-PAB596Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLCb1 (Glu316~Gly476)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1). This antibody is labeled with APC.
Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1) Polyclonal Antibody (Human, Mouse, Rat, Pig), Biotinylated
4-PAB596Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLCb1 (Glu316~Gly476)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1). This antibody is labeled with Biotin.
Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1) Polyclonal Antibody (Human, Mouse, Rat, Pig), Cy3
4-PAB596Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLCb1 (Glu316~Gly476)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1). This antibody is labeled with Cy3.
Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1) Polyclonal Antibody (Human, Mouse, Rat, Pig), FITC
4-PAB596Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLCb1 (Glu316~Gly476)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1). This antibody is labeled with FITC.
Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1) Polyclonal Antibody (Human, Mouse, Rat, Pig), HRP
4-PAB596Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLCb1 (Glu316~Gly476)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1). This antibody is labeled with HRP.
Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1) Polyclonal Antibody (Human, Mouse, Rat, Pig), PE
4-PAB596Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLCb1 (Glu316~Gly476)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1). This antibody is labeled with PE.
Plcb1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6748602 1.0 ug DNA
EUR 154
Plcb1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6748603 1.0 ug DNA
EUR 154
Plcb1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6748604 1.0 ug DNA
EUR 154
Plcb1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3836202 1.0 ug DNA
EUR 154
Plcb1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3836203 1.0 ug DNA
EUR 154
Plcb1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3836204 1.0 ug DNA
EUR 154
PLCB1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1662402 1.0 ug DNA
EUR 154
PLCB1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1662403 1.0 ug DNA
EUR 154
PLCB1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1662404 1.0 ug DNA
EUR 154
PLCB1 Protein Vector (Rat) (pPB-C-His)
PV294434 500 ng
EUR 1191
PLCB1 Protein Vector (Rat) (pPB-N-His)
PV294435 500 ng
EUR 1191
PLCB1 Protein Vector (Rat) (pPM-C-HA)
PV294436 500 ng
EUR 1191
PLCB1 Protein Vector (Rat) (pPM-C-His)
PV294437 500 ng
EUR 1191
PLCB1 Protein Vector (Human) (pPB-C-His)
PV031625 500 ng
EUR 329
PLCB1 Protein Vector (Human) (pPB-N-His)
PV031626 500 ng
EUR 329
PLCB1 Protein Vector (Human) (pPM-C-HA)
PV031627 500 ng
EUR 329
PLCB1 Protein Vector (Human) (pPM-C-His)
PV031628 500 ng
EUR 329
PLCB1 Protein Vector (Human) (pPB-C-His)
PV056365 500 ng
EUR 481
PLCB1 Protein Vector (Human) (pPB-N-His)
PV056366 500 ng
EUR 481
PLCB1 Protein Vector (Human) (pPM-C-HA)
PV056367 500 ng
EUR 481
PLCB1 Protein Vector (Human) (pPM-C-His)
PV056368 500 ng
EUR 481
PLCB1 Protein Vector (Mouse) (pPB-C-His)
PV216838 500 ng
EUR 1065
PLCB1 Protein Vector (Mouse) (pPB-N-His)
PV216839 500 ng
EUR 1065
PLCB1 Protein Vector (Mouse) (pPM-C-HA)
PV216840 500 ng
EUR 1065
PLCB1 Protein Vector (Mouse) (pPM-C-His)
PV216841 500 ng
EUR 1065
PLCB1 Protein Vector (Mouse) (pPB-C-His)
PV216842 500 ng
EUR 1065
PLCB1 Protein Vector (Mouse) (pPB-N-His)
PV216843 500 ng
EUR 1065
PLCB1 Protein Vector (Mouse) (pPM-C-HA)
PV216844 500 ng
EUR 1065

PLCB1 Rabbit Polyclonal Antibody