PLCB1 Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
PLCB1 Polyclonal Antibody |
ABP59933-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PLCB1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of PLCB1 from Human, Mouse, Rat. This PLCB1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLCB1 protein |
PLCB1 Polyclonal Antibody |
ABP59933-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PLCB1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of PLCB1 from Human, Mouse, Rat. This PLCB1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLCB1 protein |
PLCB1 Polyclonal Antibody |
ES10733-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against PLCB1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PLCB1 Polyclonal Antibody |
ES10733-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PLCB1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PLCB1 Rabbit pAb |
A1971-100ul |
Abclonal |
100 ul |
EUR 308 |
PLCB1 Rabbit pAb |
A1971-200ul |
Abclonal |
200 ul |
EUR 459 |
PLCB1 Rabbit pAb |
A1971-20ul |
Abclonal |
20 ul |
EUR 183 |
PLCB1 Rabbit pAb |
A1971-50ul |
Abclonal |
50 ul |
EUR 223 |
PLCB1 Antibody |
32528-100ul |
SAB |
100ul |
EUR 252 |
PLCB1 Antibody |
1-CSB-PA865102LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PLCB1. Recognizes PLCB1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
PLCB1 Antibody |
DF6726 |
Affbiotech |
200ul |
EUR 304 |
Description: PLCB1 Antibody detects endogenous levels of total PLCB1. |
PLCB1 Antibody |
CSB-PA018126KA01HU- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against PLCB1. Recognizes PLCB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
PLCB1 Antibody |
CSB-PA018126KA01HU-100ul |
Cusabio |
100ul |
EUR 389 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against PLCB1. Recognizes PLCB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
PLCB1 antibody |
70R-5669 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal PLCB1 antibody |
Polyclonal PLCB1 Antibody (C-term) |
AMR09343G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PLCB1 (C-term). This antibody is tested and proven to work in the following applications: |
Polyclonal Plcb1 Antibody - C-terminal region |
AMM07235G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Plcb1 - C-terminal region. This antibody is tested and proven to work in the following applications: |
PLCB1 Conjugated Antibody |
C32528 |
SAB |
100ul |
EUR 397 |
anti- PLCB1 antibody |
FNab10119 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: phospholipase C, beta 1
- Uniprot ID: Q9NQ66
- Gene ID: 23236
- Research Area: Signal Transduction
|
Description: Antibody raised against PLCB1 |
Anti-PLCB1 antibody |
STJ25023 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals. This gene is activated by two G-protein alpha subunits, alpha-q and alpha-11. Two transcript variants encoding different isoforms have been found for this gene. |
Anti-PLCB1 antibody |
STJ191891 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PLCB1 |
Phospholipase C beta 1 (PLCB1) polyclonal antibody |
ABP-PAB-01053 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Miscellaneous
- Brand:
|
PLCB1 siRNA |
20-abx904062 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PLCB1 siRNA |
20-abx928833 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PLCB1 siRNA |
20-abx928834 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PLCB1 Antibody, HRP conjugated |
1-CSB-PA865102LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PLCB1. Recognizes PLCB1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
PLCB1 Antibody, FITC conjugated |
1-CSB-PA865102LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PLCB1. Recognizes PLCB1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
PLCB1 Antibody, Biotin conjugated |
1-CSB-PA865102LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PLCB1. Recognizes PLCB1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
PLCB1 Blocking Peptide |
33R-2278 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PLCB1 antibody, catalog no. 70R-5669 |
PLCB1 Blocking Peptide |
DF6726-BP |
Affbiotech |
1mg |
EUR 195 |
PLCB1 cloning plasmid |
CSB-CL865102HU1-10ug |
Cusabio |
10ug |
EUR 1326 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3651
- Sequence: atggccggggctcaacccggagtgcacgccttgcaactcaagcccgtgtgcgtgtccgacagcctcaagaagggcaccaaattcgtcaagtgggatgatgactcaactattgttactccaattattttgaggactgaccctcagggatttttcttttactggacagatcaaaaca
- Show more
|
Description: A cloning plasmid for the PLCB1 gene. |
PLCB1 cloning plasmid |
CSB-CL865102HU2-10ug |
Cusabio |
10ug |
EUR 1284 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3522
- Sequence: atggccggggctcaacccggagtgcacgccttgcaactcaagcccgtgtgcgtgtccgacagcctcaagaagggcaccaaattcgtcaagtgggatgatgactcaactattgttactccaattattttgaggactgaccctcagggatttttcttttactggacagatcaaaaca
- Show more
|
Description: A cloning plasmid for the PLCB1 gene. |
Phospholipase C Beta 1 (PLCB1) Antibody |
abx117174-100ug |
Abbexa |
100 ug |
EUR 467 |
- Shipped within 5-10 working days.
|
Phospholipase C Beta 1 (PLCB1) Antibody |
abx034343-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Phospholipase C Beta 1 (PLCB1) Antibody |
abx034343-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Phospholipase C Beta 1 (PLCB1) Antibody |
20-abx302318 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Phospholipase C Beta 1 (PLCB1) Antibody |
20-abx001606 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Mouse PLCB1 shRNA Plasmid |
20-abx972088 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat PLCB1 shRNA Plasmid |
20-abx984582 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human PLCB1 shRNA Plasmid |
20-abx958111 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Phospholipase C Beta 1 (PLCB1) Antibody (HRP) |
20-abx316540 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Phospholipase C Beta 1 (PLCB1) Antibody (FITC) |
20-abx316541 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Phospholipase C Beta 1 (PLCB1) Antibody (Biotin) |
20-abx316542 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-Phospholipase C beta 1/PLCB1 Antibody |
PB9346 |
BosterBio |
100ug/vial |
EUR 294 |
Rabbit phosphatidylinositol 4,5 bisphosphate phosphodiesterase β 1(PLCB1) ELISA kit |
E04P0760-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit phosphatidylinositol 4,5 bisphosphate phosphodiesterase β 1(PLCB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit phosphatidylinositol 4,5 bisphosphate phosphodiesterase β 1(PLCB1) ELISA kit |
E04P0760-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit phosphatidylinositol 4,5 bisphosphate phosphodiesterase β 1(PLCB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit phosphatidylinositol 4,5 bisphosphate phosphodiesterase β 1(PLCB1) ELISA kit |
E04P0760-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit phosphatidylinositol 4,5 bisphosphate phosphodiesterase β 1(PLCB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Phospholipase C Beta 1, Phosphoinositide-Specific (PLCB1) ELISA Kit |
abx363285-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Plcb1 ORF Vector (Rat) (pORF) |
ORF073609 |
ABM |
1.0 ug DNA |
EUR 506 |
PLCB1 ORF Vector (Human) (pORF) |
ORF014092 |
ABM |
1.0 ug DNA |
EUR 354 |
PLCB1 ORF Vector (Human) (pORF) |
ORF007907 |
ABM |
1.0 ug DNA |
EUR 95 |
Plcb1 ORF Vector (Mouse) (pORF) |
ORF054210 |
ABM |
1.0 ug DNA |
EUR 506 |
Plcb1 ORF Vector (Mouse) (pORF) |
ORF054211 |
ABM |
1.0 ug DNA |
EUR 506 |
PLCB1 ELISA Kit (Human) (OKEH04261) |
OKEH04261 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals. This gene is activated by two G-protein alpha subunits, alpha-q and alpha-11. Two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.045 ng/mL |
PLCB1 ELISA Kit (Mouse) (OKEH05393) |
OKEH05393 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: The production of the second messenger molecules diacylglycerol (DAG) and inositol 1,4,5-trisphosphate (IP3) is mediated by activated phosphatidylinositol-specific phospholipase C enzymes.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.16 ng/mL |
PLCB1 ELISA Kit (Rat) (OKEH06133) |
OKEH06133 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: The production of the second messenger molecules diacylglycerol (DAG) and inositol 1,4,5-trisphosphate (IP3) is mediated by activated phosphatidylinositol-specific phospholipase C enzymes. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.162 ng/mL |
PLCB1 ELISA Kit (Bovine) (OKEH08391) |
OKEH08391 |
Aviva Systems Biology |
96 Wells |
EUR 1092 |
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.08ng/mL |
Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1) Antibody |
20-abx131473 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1149.00
-
EUR 565.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Plcb1 sgRNA CRISPR Lentivector set (Rat) |
K6748601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Plcb1 sgRNA CRISPR Lentivector set (Mouse) |
K3836201 |
ABM |
3 x 1.0 ug |
EUR 339 |
PLCB1 sgRNA CRISPR Lentivector set (Human) |
K1662401 |
ABM |
3 x 1.0 ug |
EUR 339 |
PLCB1-IT1 ORF Vector (Human) (pORF) |
ORF027934 |
ABM |
1.0 ug DNA |
Ask for price |
Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1) Polyclonal Antibody (Human, Mouse, Rat, Pig) |
4-PAB596Hu01 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLCb1 (Glu316~Gly476)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1) |
Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1) Polyclonal Antibody (Human, Mouse, Rat, Pig), APC |
4-PAB596Hu01-APC |
Cloud-Clone |
-
EUR 333.00
-
EUR 3113.00
-
EUR 872.00
-
EUR 423.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLCb1 (Glu316~Gly476)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1). This antibody is labeled with APC. |
Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1) Polyclonal Antibody (Human, Mouse, Rat, Pig), Biotinylated |
4-PAB596Hu01-Biotin |
Cloud-Clone |
-
EUR 303.00
-
EUR 2341.00
-
EUR 697.00
-
EUR 369.00
-
EUR 216.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLCb1 (Glu316~Gly476)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1). This antibody is labeled with Biotin. |
Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1) Polyclonal Antibody (Human, Mouse, Rat, Pig), Cy3 |
4-PAB596Hu01-Cy3 |
Cloud-Clone |
-
EUR 403.00
-
EUR 4109.00
-
EUR 1121.00
-
EUR 523.00
-
EUR 245.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLCb1 (Glu316~Gly476)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1). This antibody is labeled with Cy3. |
Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1) Polyclonal Antibody (Human, Mouse, Rat, Pig), FITC |
4-PAB596Hu01-FITC |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLCb1 (Glu316~Gly476)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1). This antibody is labeled with FITC. |
Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1) Polyclonal Antibody (Human, Mouse, Rat, Pig), HRP |
4-PAB596Hu01-HRP |
Cloud-Clone |
-
EUR 305.00
-
EUR 2714.00
-
EUR 772.00
-
EUR 383.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLCb1 (Glu316~Gly476)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1). This antibody is labeled with HRP. |
Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1) Polyclonal Antibody (Human, Mouse, Rat, Pig), PE |
4-PAB596Hu01-PE |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLCb1 (Glu316~Gly476)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Phospholipase C Beta 1, Phosphoinositide Specific (PLCb1). This antibody is labeled with PE. |
Plcb1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6748602 |
ABM |
1.0 ug DNA |
EUR 154 |
Plcb1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6748603 |
ABM |
1.0 ug DNA |
EUR 154 |
Plcb1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6748604 |
ABM |
1.0 ug DNA |
EUR 154 |
Plcb1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3836202 |
ABM |
1.0 ug DNA |
EUR 154 |
Plcb1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3836203 |
ABM |
1.0 ug DNA |
EUR 154 |
Plcb1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3836204 |
ABM |
1.0 ug DNA |
EUR 154 |
PLCB1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1662402 |
ABM |
1.0 ug DNA |
EUR 154 |
PLCB1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1662403 |
ABM |
1.0 ug DNA |
EUR 154 |
PLCB1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1662404 |
ABM |
1.0 ug DNA |
EUR 154 |
PLCB1 Protein Vector (Rat) (pPB-C-His) |
PV294434 |
ABM |
500 ng |
EUR 1191 |
PLCB1 Protein Vector (Rat) (pPB-N-His) |
PV294435 |
ABM |
500 ng |
EUR 1191 |
PLCB1 Protein Vector (Rat) (pPM-C-HA) |
PV294436 |
ABM |
500 ng |
EUR 1191 |
PLCB1 Protein Vector (Rat) (pPM-C-His) |
PV294437 |
ABM |
500 ng |
EUR 1191 |
PLCB1 Protein Vector (Human) (pPB-C-His) |
PV031625 |
ABM |
500 ng |
EUR 329 |
PLCB1 Protein Vector (Human) (pPB-N-His) |
PV031626 |
ABM |
500 ng |
EUR 329 |
PLCB1 Protein Vector (Human) (pPM-C-HA) |
PV031627 |
ABM |
500 ng |
EUR 329 |
PLCB1 Protein Vector (Human) (pPM-C-His) |
PV031628 |
ABM |
500 ng |
EUR 329 |
PLCB1 Protein Vector (Human) (pPB-C-His) |
PV056365 |
ABM |
500 ng |
EUR 481 |
PLCB1 Protein Vector (Human) (pPB-N-His) |
PV056366 |
ABM |
500 ng |
EUR 481 |
PLCB1 Protein Vector (Human) (pPM-C-HA) |
PV056367 |
ABM |
500 ng |
EUR 481 |
PLCB1 Protein Vector (Human) (pPM-C-His) |
PV056368 |
ABM |
500 ng |
EUR 481 |
PLCB1 Protein Vector (Mouse) (pPB-C-His) |
PV216838 |
ABM |
500 ng |
EUR 1065 |
PLCB1 Protein Vector (Mouse) (pPB-N-His) |
PV216839 |
ABM |
500 ng |
EUR 1065 |
PLCB1 Protein Vector (Mouse) (pPM-C-HA) |
PV216840 |
ABM |
500 ng |
EUR 1065 |
PLCB1 Protein Vector (Mouse) (pPM-C-His) |
PV216841 |
ABM |
500 ng |
EUR 1065 |
PLCB1 Protein Vector (Mouse) (pPB-C-His) |
PV216842 |
ABM |
500 ng |
EUR 1065 |
PLCB1 Protein Vector (Mouse) (pPB-N-His) |
PV216843 |
ABM |
500 ng |
EUR 1065 |
PLCB1 Protein Vector (Mouse) (pPM-C-HA) |
PV216844 |
ABM |
500 ng |
EUR 1065 |
PLCB1 Rabbit Polyclonal Antibody