PLCB4 Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
 PLCB4 Polyclonal Antibody |
|
ABP59934-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human PLCB4 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of PLCB4 from Human, Rat. This PLCB4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLCB4 protein |
PLCB4 Polyclonal Antibody |
|
ABP59934-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PLCB4 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of PLCB4 from Human, Rat. This PLCB4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLCB4 protein |
PLCB4 Polyclonal Antibody |
|
ABP59934-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PLCB4 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of PLCB4 from Human, Rat. This PLCB4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLCB4 protein |
 PLCB4 antibody |
|
70R-35323 |
Fitzgerald |
100 ug |
EUR 349 |
|
Description: Purified Rabbit polyclonal PLCB4 antibody |
 PLCB4 Antibody |
|
44841-100ul |
SAB |
100ul |
EUR 252 |
PLCB4 Antibody |
|
44841-50ul |
SAB |
50ul |
EUR 187 |
PLCB4 Antibody |
|
DF2564 |
Affbiotech |
200ul |
EUR 304 |
|
Description: PLCB4 antibody detects endogenous levels of total PLCB4. |
 PLCB4 Conjugated Antibody |
|
C44841 |
SAB |
100ul |
EUR 397 |
 Anti-PLCB4 antibody |
|
STJ191892 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to PLCB4 |
 PLCB4 siRNA |
|
20-abx928838 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PLCB4 siRNA |
|
20-abx928839 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Polyclonal Antibody (Human)) Phospholipase C Beta 4 (PLCb4) Polyclonal Antibody (Human) |
|
4-PAD836Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLCb4 (Ala2~Gln250)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Phospholipase C Beta 4 (PLCb4) |
 PLCB4 cloning plasmid |
|
CSB-CL614882HU-10ug |
Cusabio |
10ug |
EUR 1249 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3528
- Sequence: atggccaaaccttatgaatttaactggcagaaggaagttccctcctttttgcaagaaggaacagtttttgacagatacgaggaggaatcctttgtgtttgaacccaactgcctcttcaaagtggatgagtttggcttctttctgacatggagaagtgaaggcaaggaaggacagg
- Show more
|
|
Description: A cloning plasmid for the PLCB4 gene. |
 PLCB4 Blocking Peptide |
|
DF2564-BP |
Affbiotech |
1mg |
EUR 195 |
 Recombinant human PLCB4 |
|
P1005 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: Q15147
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
|
Description: Recombinant protein for human PLCB4 |
 Polyclonal Antibody (Human), APC) Phospholipase C Beta 4 (PLCb4) Polyclonal Antibody (Human), APC |
|
4-PAD836Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLCb4 (Ala2~Gln250)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Phospholipase C Beta 4 (PLCb4). This antibody is labeled with APC. |
 Polyclonal Antibody (Human), Biotinylated) Phospholipase C Beta 4 (PLCb4) Polyclonal Antibody (Human), Biotinylated |
|
4-PAD836Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLCb4 (Ala2~Gln250)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Phospholipase C Beta 4 (PLCb4). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Human), Cy3) Phospholipase C Beta 4 (PLCb4) Polyclonal Antibody (Human), Cy3 |
|
4-PAD836Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLCb4 (Ala2~Gln250)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Phospholipase C Beta 4 (PLCb4). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Human), FITC) Phospholipase C Beta 4 (PLCb4) Polyclonal Antibody (Human), FITC |
|
4-PAD836Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLCb4 (Ala2~Gln250)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Phospholipase C Beta 4 (PLCb4). This antibody is labeled with FITC. |
 Polyclonal Antibody (Human), HRP) Phospholipase C Beta 4 (PLCb4) Polyclonal Antibody (Human), HRP |
|
4-PAD836Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLCb4 (Ala2~Gln250)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Phospholipase C Beta 4 (PLCb4). This antibody is labeled with HRP. |
 Polyclonal Antibody (Human), PE) Phospholipase C Beta 4 (PLCb4) Polyclonal Antibody (Human), PE |
|
4-PAD836Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLCb4 (Ala2~Gln250)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Phospholipase C Beta 4 (PLCb4). This antibody is labeled with PE. |
 Rat PLCB4 shRNA Plasmid |
|
20-abx984749 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human PLCB4 shRNA Plasmid |
|
20-abx953572 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Antibody) Phospholipase C Beta 4 (PLCb4) Antibody |
|
20-abx131466 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
 Antibody) Phospholipase C Beta 4 (PLCB4) Antibody |
|
abx037229-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Phospholipase C Beta 4 (PLCB4) Antibody |
|
20-abx219523 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Polyclonal Antibody (Human), APC-Cy7) Phospholipase C Beta 4 (PLCb4) Polyclonal Antibody (Human), APC-Cy7 |
|
4-PAD836Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLCb4 (Ala2~Gln250)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Phospholipase C Beta 4 (PLCb4). This antibody is labeled with APC-Cy7. |
 (pORF)) Plcb4 ORF Vector (Rat) (pORF) |
|
ORF073612 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) PLCB4 ORF Vector (Human) (pORF) |
|
ORF014093 |
ABM |
1.0 ug DNA |
EUR 354 |
 (pORF)) Plcb4 ORF Vector (Mouse) (pORF) |
|
ORF054214 |
ABM |
1.0 ug DNA |
EUR 506 |
) PLCB4 sgRNA CRISPR Lentivector set (Human) |
|
K1662701 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Plcb4 sgRNA CRISPR Lentivector set (Mouse) |
|
K3395901 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Plcb4 sgRNA CRISPR Lentivector set (Rat) |
|
K6820901 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Recombinant Phospholipase C Beta 4 (PLCb4) |
|
4-RPD836Hu01 |
Cloud-Clone |
-
EUR 422.56
-
EUR 216.00
-
EUR 1309.60
-
EUR 503.20
-
EUR 906.40
-
EUR 346.00
-
EUR 3124.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q15147
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 32.1kDa
- Isoelectric Point: Inquire
|
|
Description: Recombinant Human Phospholipase C Beta 4 expressed in: E.coli |
 Protein) Human Phospholipase C Beta 4 (PLCb4) Protein |
|
20-abx650490 |
Abbexa |
-
EUR 592.00
-
EUR 258.00
-
EUR 1776.00
-
EUR 704.00
-
EUR 439.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
 (Target 1)) PLCB4 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1662702 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) PLCB4 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1662703 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) PLCB4 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1662704 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Plcb4 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3395902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Plcb4 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3395903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Plcb4 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3395904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Plcb4 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6820902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Plcb4 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6820903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Plcb4 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6820904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) PLCB4 Protein Vector (Human) (pPB-C-His) |
|
PV056369 |
ABM |
500 ng |
EUR 481 |
 (pPB-N-His)) PLCB4 Protein Vector (Human) (pPB-N-His) |
|
PV056370 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-HA)) PLCB4 Protein Vector (Human) (pPM-C-HA) |
|
PV056371 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-His)) PLCB4 Protein Vector (Human) (pPM-C-His) |
|
PV056372 |
ABM |
500 ng |
EUR 481 |
 (pPB-C-His)) PLCB4 Protein Vector (Mouse) (pPB-C-His) |
|
PV216854 |
ABM |
500 ng |
EUR 1065 |
 (pPB-N-His)) PLCB4 Protein Vector (Mouse) (pPB-N-His) |
|
PV216855 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-HA)) PLCB4 Protein Vector (Mouse) (pPM-C-HA) |
|
PV216856 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-His)) PLCB4 Protein Vector (Mouse) (pPM-C-His) |
|
PV216857 |
ABM |
500 ng |
EUR 1065 |
 (pPB-C-His)) PLCB4 Protein Vector (Rat) (pPB-C-His) |
|
PV294446 |
ABM |
500 ng |
EUR 1191 |
 (pPB-N-His)) PLCB4 Protein Vector (Rat) (pPB-N-His) |
|
PV294447 |
ABM |
500 ng |
EUR 1191 |
 (pPM-C-HA)) PLCB4 Protein Vector (Rat) (pPM-C-HA) |
|
PV294448 |
ABM |
500 ng |
EUR 1191 |
 (pPM-C-His)) PLCB4 Protein Vector (Rat) (pPM-C-His) |
|
PV294449 |
ABM |
500 ng |
EUR 1191 |
 Plcb4 3'UTR GFP Stable Cell Line |
|
TU166499 |
ABM |
1.0 ml |
Ask for price |
 PLCB4 3'UTR Luciferase Stable Cell Line |
|
TU018208 |
ABM |
1.0 ml |
EUR 1521 |
 Plcb4 3'UTR Luciferase Stable Cell Line |
|
TU116499 |
ABM |
1.0 ml |
Ask for price |
 PLCB4 3'UTR GFP Stable Cell Line |
|
TU068208 |
ABM |
1.0 ml |
EUR 1521 |
Plcb4 3'UTR GFP Stable Cell Line |
|
TU266359 |
ABM |
1.0 ml |
Ask for price |
Plcb4 3'UTR Luciferase Stable Cell Line |
|
TU216359 |
ABM |
1.0 ml |
Ask for price |
 (CMV) (pLenti-GIII-CMV)) PLCB4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV680863 |
ABM |
1.0 ug DNA |
EUR 1355 |
 (UbC) (pLenti-GIII-UbC)) PLCB4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV680867 |
ABM |
1.0 ug DNA |
EUR 1355 |
 (EF1a) (pLenti-GIII-EF1a)) PLCB4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV680868 |
ABM |
1.0 ug DNA |
EUR 1355 |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
PLCB4 Rabbit Polyclonal Antibody
