PLCB4 Rabbit Polyclonal Antibody

Order Now:

PLCB4 Polyclonal Antibody

ABP59934-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PLCB4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of PLCB4 from Human, Rat. This PLCB4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLCB4 protein

PLCB4 Polyclonal Antibody

ABP59934-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PLCB4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of PLCB4 from Human, Rat. This PLCB4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLCB4 protein

PLCB4 Polyclonal Antibody

ABP59934-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PLCB4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of PLCB4 from Human, Rat. This PLCB4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLCB4 protein

PLCB4 antibody

70R-35323 100 ug
EUR 349
Description: Purified Rabbit polyclonal PLCB4 antibody

PLCB4 Antibody

ABD2564 100 ug
EUR 438

PLCB4 Antibody

44841-100ul 100ul
EUR 252

PLCB4 Antibody

44841-50ul 50ul
EUR 187

PLCB4 Antibody

DF2564 200ul
EUR 304
Description: PLCB4 antibody detects endogenous levels of total PLCB4.

Plcb4/ Rat Plcb4 ELISA Kit

ELI-45330r 96 Tests
EUR 886

PLCB4 Conjugated Antibody

C44841 100ul
EUR 397

Anti-PLCB4 antibody

STJ191892 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PLCB4


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Phospholipase C Beta 4 (PLCb4) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLCb4 (Ala2~Gln250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Phospholipase C Beta 4 (PLCb4)

PLCB4 cloning plasmid

CSB-CL614882HU-10ug 10ug
EUR 1249
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3528
  • Sequence: atggccaaaccttatgaatttaactggcagaaggaagttccctcctttttgcaagaaggaacagtttttgacagatacgaggaggaatcctttgtgtttgaacccaactgcctcttcaaagtggatgagtttggcttctttctgacatggagaagtgaaggcaaggaaggacagg
  • Show more
Description: A cloning plasmid for the PLCB4 gene.

PLCB4 Blocking Peptide

DF2564-BP 1mg
EUR 195

Recombinant human PLCB4

P1005 100ug Ask for price
  • Uniprot ID: Q15147
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human PLCB4


PVT14470 2 ug
EUR 495

Phospholipase C Beta 4 (PLCb4) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLCb4 (Ala2~Gln250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Phospholipase C Beta 4 (PLCb4). This antibody is labeled with APC.

Phospholipase C Beta 4 (PLCb4) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLCb4 (Ala2~Gln250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Phospholipase C Beta 4 (PLCb4). This antibody is labeled with Biotin.

Phospholipase C Beta 4 (PLCb4) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLCb4 (Ala2~Gln250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Phospholipase C Beta 4 (PLCb4). This antibody is labeled with Cy3.

Phospholipase C Beta 4 (PLCb4) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLCb4 (Ala2~Gln250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Phospholipase C Beta 4 (PLCb4). This antibody is labeled with FITC.

Phospholipase C Beta 4 (PLCb4) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLCb4 (Ala2~Gln250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Phospholipase C Beta 4 (PLCb4). This antibody is labeled with HRP.

Phospholipase C Beta 4 (PLCb4) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLCb4 (Ala2~Gln250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Phospholipase C Beta 4 (PLCb4). This antibody is labeled with PE.

Rat PLCB4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-15225b 96 Tests
EUR 928


ELI-15380h 96 Tests
EUR 824

Human PLCB4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Phospholipase C Beta 4 (PLCb4) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Phospholipase C Beta 4 (PLCB4) Antibody

abx037229-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Phospholipase C Beta 4 (PLCB4) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Phospholipase C Beta 4 (PLCb4) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: PLCb4 (Ala2~Gln250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Phospholipase C Beta 4 (PLCb4). This antibody is labeled with APC-Cy7.

Plcb4 ORF Vector (Rat) (pORF)

ORF073612 1.0 ug DNA
EUR 506

PLCB4 ORF Vector (Human) (pORF)

ORF014093 1.0 ug DNA
EUR 354

Plcb4 ORF Vector (Mouse) (pORF)

ORF054214 1.0 ug DNA
EUR 506

PLCB4 sgRNA CRISPR Lentivector set (Human)

K1662701 3 x 1.0 ug
EUR 339

Plcb4 sgRNA CRISPR Lentivector set (Mouse)

K3395901 3 x 1.0 ug
EUR 339

Plcb4 sgRNA CRISPR Lentivector set (Rat)

K6820901 3 x 1.0 ug
EUR 339

Recombinant Phospholipase C Beta 4 (PLCb4)

  • EUR 422.56
  • EUR 216.00
  • EUR 1309.60
  • EUR 503.20
  • EUR 906.40
  • EUR 346.00
  • EUR 3124.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q15147
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Phospholipase C Beta 4 expressed in: E.coli

Human Phospholipase C Beta 4 (PLCb4) Protein

  • EUR 592.00
  • EUR 258.00
  • EUR 1776.00
  • EUR 704.00
  • EUR 439.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

PLCB4 sgRNA CRISPR Lentivector (Human) (Target 1)

K1662702 1.0 ug DNA
EUR 154

PLCB4 sgRNA CRISPR Lentivector (Human) (Target 2)

K1662703 1.0 ug DNA
EUR 154

PLCB4 sgRNA CRISPR Lentivector (Human) (Target 3)

K1662704 1.0 ug DNA
EUR 154

Plcb4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3395902 1.0 ug DNA
EUR 154

Plcb4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3395903 1.0 ug DNA
EUR 154

Plcb4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3395904 1.0 ug DNA
EUR 154

Plcb4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6820902 1.0 ug DNA
EUR 154

Plcb4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6820903 1.0 ug DNA
EUR 154

Plcb4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6820904 1.0 ug DNA
EUR 154

PLCB4 Protein Vector (Human) (pPB-C-His)

PV056369 500 ng
EUR 481

PLCB4 Protein Vector (Human) (pPB-N-His)

PV056370 500 ng
EUR 481

PLCB4 Protein Vector (Human) (pPM-C-HA)

PV056371 500 ng
EUR 481

PLCB4 Protein Vector (Human) (pPM-C-His)

PV056372 500 ng
EUR 481

PLCB4 Protein Vector (Mouse) (pPB-C-His)

PV216854 500 ng
EUR 1065

PLCB4 Protein Vector (Mouse) (pPB-N-His)

PV216855 500 ng
EUR 1065

PLCB4 Protein Vector (Mouse) (pPM-C-HA)

PV216856 500 ng
EUR 1065

PLCB4 Protein Vector (Mouse) (pPM-C-His)

PV216857 500 ng
EUR 1065

PLCB4 Protein Vector (Rat) (pPB-C-His)

PV294446 500 ng
EUR 1191

PLCB4 Protein Vector (Rat) (pPB-N-His)

PV294447 500 ng
EUR 1191

PLCB4 Protein Vector (Rat) (pPM-C-HA)

PV294448 500 ng
EUR 1191

PLCB4 Protein Vector (Rat) (pPM-C-His)

PV294449 500 ng
EUR 1191

Plcb4 3'UTR GFP Stable Cell Line

TU166499 1.0 ml Ask for price

PLCB4 3'UTR Luciferase Stable Cell Line

TU018208 1.0 ml
EUR 1521

Plcb4 3'UTR Luciferase Stable Cell Line

TU116499 1.0 ml Ask for price

PLCB4 3'UTR GFP Stable Cell Line

TU068208 1.0 ml
EUR 1521

Plcb4 3'UTR GFP Stable Cell Line

TU266359 1.0 ml Ask for price

Plcb4 3'UTR Luciferase Stable Cell Line

TU216359 1.0 ml Ask for price

PLCB4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV680863 1.0 ug DNA
EUR 1355

PLCB4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV680867 1.0 ug DNA
EUR 1355

PLCB4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV680868 1.0 ug DNA
EUR 1355

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

PLCB4 Rabbit Polyclonal Antibody