PLCB4 Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
PLCB4 Polyclonal Antibody |
ABP59934-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PLCB4 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of PLCB4 from Human, Rat. This PLCB4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PLCB4 protein |
PLCB4 Polyclonal Antibody |
ES10734-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against PLCB4 from Human/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PLCB4 Polyclonal Antibody |
ES10734-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PLCB4 from Human/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PLCB4 Antibody |
44841-100ul |
SAB |
100ul |
EUR 252 |
PLCB4 Antibody |
44841-50ul |
SAB |
50ul |
EUR 187 |
PLCB4 Antibody |
DF2564 |
Affbiotech |
200ul |
EUR 304 |
Description: PLCB4 antibody detects endogenous levels of total PLCB4. |
PLCB4 antibody |
70R-35323 |
Fitzgerald |
100 ug |
EUR 349 |
Description: Purified Rabbit polyclonal PLCB4 antibody |
PLCB4 Conjugated Antibody |
C44841 |
SAB |
100ul |
EUR 397 |
Anti-PLCB4 antibody |
STJ191892 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PLCB4 |
PLCB4 siRNA |
20-abx928838 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PLCB4 siRNA |
20-abx928839 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Phospholipase C Beta 4 (PLCb4) Polyclonal Antibody (Human) |
4-PAD836Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLCb4 (Ala2~Gln250)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Phospholipase C Beta 4 (PLCb4) |
PLCB4 Blocking Peptide |
DF2564-BP |
Affbiotech |
1mg |
EUR 195 |
PLCB4 cloning plasmid |
CSB-CL614882HU-10ug |
Cusabio |
10ug |
EUR 1249 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3528
- Sequence: atggccaaaccttatgaatttaactggcagaaggaagttccctcctttttgcaagaaggaacagtttttgacagatacgaggaggaatcctttgtgtttgaacccaactgcctcttcaaagtggatgagtttggcttctttctgacatggagaagtgaaggcaaggaaggacagg
- Show more
|
Description: A cloning plasmid for the PLCB4 gene. |
Recombinant human PLCB4 |
P1005 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: Q15147
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for human PLCB4 |
Phospholipase C Beta 4 (PLCb4) Polyclonal Antibody (Human), APC |
4-PAD836Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLCb4 (Ala2~Gln250)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Phospholipase C Beta 4 (PLCb4). This antibody is labeled with APC. |
Phospholipase C Beta 4 (PLCb4) Polyclonal Antibody (Human), Biotinylated |
4-PAD836Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLCb4 (Ala2~Gln250)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Phospholipase C Beta 4 (PLCb4). This antibody is labeled with Biotin. |
Phospholipase C Beta 4 (PLCb4) Polyclonal Antibody (Human), Cy3 |
4-PAD836Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLCb4 (Ala2~Gln250)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Phospholipase C Beta 4 (PLCb4). This antibody is labeled with Cy3. |
Phospholipase C Beta 4 (PLCb4) Polyclonal Antibody (Human), FITC |
4-PAD836Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLCb4 (Ala2~Gln250)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Phospholipase C Beta 4 (PLCb4). This antibody is labeled with FITC. |
Phospholipase C Beta 4 (PLCb4) Polyclonal Antibody (Human), HRP |
4-PAD836Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLCb4 (Ala2~Gln250)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Phospholipase C Beta 4 (PLCb4). This antibody is labeled with HRP. |
Phospholipase C Beta 4 (PLCb4) Polyclonal Antibody (Human), PE |
4-PAD836Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLCb4 (Ala2~Gln250)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Phospholipase C Beta 4 (PLCb4). This antibody is labeled with PE. |
Rat PLCB4 shRNA Plasmid |
20-abx984749 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human PLCB4 shRNA Plasmid |
20-abx953572 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Phospholipase C Beta 4 (PLCB4) Antibody |
20-abx219523 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Phospholipase C Beta 4 (PLCB4) Antibody |
abx037229-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Phospholipase C Beta 4 (PLCb4) Antibody |
20-abx131466 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Phospholipase C Beta 4 (PLCb4) Polyclonal Antibody (Human), APC-Cy7 |
4-PAD836Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PLCb4 (Ala2~Gln250)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Phospholipase C Beta 4 (PLCb4). This antibody is labeled with APC-Cy7. |
Plcb4 ORF Vector (Rat) (pORF) |
ORF073612 |
ABM |
1.0 ug DNA |
EUR 506 |
PLCB4 ORF Vector (Human) (pORF) |
ORF014093 |
ABM |
1.0 ug DNA |
EUR 354 |
Plcb4 ORF Vector (Mouse) (pORF) |
ORF054214 |
ABM |
1.0 ug DNA |
EUR 506 |
Plcb4 sgRNA CRISPR Lentivector set (Rat) |
K6820901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Plcb4 sgRNA CRISPR Lentivector set (Mouse) |
K3395901 |
ABM |
3 x 1.0 ug |
EUR 339 |
PLCB4 sgRNA CRISPR Lentivector set (Human) |
K1662701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Recombinant Phospholipase C Beta 4 (PLCb4) |
4-RPD836Hu01 |
Cloud-Clone |
-
EUR 422.56
-
EUR 216.00
-
EUR 1309.60
-
EUR 503.20
-
EUR 906.40
-
EUR 346.00
-
EUR 3124.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q15147
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 32.1kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Phospholipase C Beta 4 expressed in: E.coli |
Human Phospholipase C Beta 4 (PLCb4) Protein |
20-abx650490 |
Abbexa |
-
EUR 592.00
-
EUR 258.00
-
EUR 1776.00
-
EUR 704.00
-
EUR 439.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Plcb4 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6820902 |
ABM |
1.0 ug DNA |
EUR 154 |
Plcb4 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6820903 |
ABM |
1.0 ug DNA |
EUR 154 |
Plcb4 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6820904 |
ABM |
1.0 ug DNA |
EUR 154 |
Plcb4 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3395902 |
ABM |
1.0 ug DNA |
EUR 154 |
Plcb4 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3395903 |
ABM |
1.0 ug DNA |
EUR 154 |
Plcb4 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3395904 |
ABM |
1.0 ug DNA |
EUR 154 |
PLCB4 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1662702 |
ABM |
1.0 ug DNA |
EUR 154 |
PLCB4 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1662703 |
ABM |
1.0 ug DNA |
EUR 154 |
PLCB4 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1662704 |
ABM |
1.0 ug DNA |
EUR 154 |
PLCB4 Protein Vector (Rat) (pPB-C-His) |
PV294446 |
ABM |
500 ng |
EUR 1191 |
PLCB4 Protein Vector (Rat) (pPB-N-His) |
PV294447 |
ABM |
500 ng |
EUR 1191 |
PLCB4 Protein Vector (Rat) (pPM-C-HA) |
PV294448 |
ABM |
500 ng |
EUR 1191 |
PLCB4 Protein Vector (Rat) (pPM-C-His) |
PV294449 |
ABM |
500 ng |
EUR 1191 |
PLCB4 Protein Vector (Human) (pPB-C-His) |
PV056369 |
ABM |
500 ng |
EUR 481 |
PLCB4 Protein Vector (Human) (pPB-N-His) |
PV056370 |
ABM |
500 ng |
EUR 481 |
PLCB4 Protein Vector (Human) (pPM-C-HA) |
PV056371 |
ABM |
500 ng |
EUR 481 |
PLCB4 Protein Vector (Human) (pPM-C-His) |
PV056372 |
ABM |
500 ng |
EUR 481 |
PLCB4 Protein Vector (Mouse) (pPB-C-His) |
PV216854 |
ABM |
500 ng |
EUR 1065 |
PLCB4 Protein Vector (Mouse) (pPB-N-His) |
PV216855 |
ABM |
500 ng |
EUR 1065 |
PLCB4 Protein Vector (Mouse) (pPM-C-HA) |
PV216856 |
ABM |
500 ng |
EUR 1065 |
PLCB4 Protein Vector (Mouse) (pPM-C-His) |
PV216857 |
ABM |
500 ng |
EUR 1065 |
Plcb4 3'UTR Luciferase Stable Cell Line |
TU116499 |
ABM |
1.0 ml |
Ask for price |
Plcb4 3'UTR GFP Stable Cell Line |
TU166499 |
ABM |
1.0 ml |
Ask for price |
Plcb4 3'UTR Luciferase Stable Cell Line |
TU216359 |
ABM |
1.0 ml |
Ask for price |
Plcb4 3'UTR GFP Stable Cell Line |
TU266359 |
ABM |
1.0 ml |
Ask for price |
PLCB4 3'UTR GFP Stable Cell Line |
TU068208 |
ABM |
1.0 ml |
EUR 1521 |
PLCB4 3'UTR Luciferase Stable Cell Line |
TU018208 |
ABM |
1.0 ml |
EUR 1521 |
PLCB4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV680863 |
ABM |
1.0 ug DNA |
EUR 1355 |
PLCB4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV680867 |
ABM |
1.0 ug DNA |
EUR 1355 |
PLCB4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV680868 |
ABM |
1.0 ug DNA |
EUR 1355 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
PLCB4 Rabbit Polyclonal Antibody