RIPK1 Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
RIPK1 Polyclonal Antibody |
ABP60179-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human RIPK1 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of RIPK1 from Human. This RIPK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIPK1 protein |
RIPK1 Polyclonal Antibody |
ES10796-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against RIPK1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RIPK1 Polyclonal Antibody |
ES10796-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against RIPK1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RIPK1 Rabbit pAb |
A7414-100ul |
Abclonal |
100 ul |
EUR 308 |
RIPK1 Rabbit pAb |
A7414-200ul |
Abclonal |
200 ul |
EUR 459 |
RIPK1 Rabbit pAb |
A7414-20ul |
Abclonal |
20 ul |
EUR 183 |
RIPK1 Rabbit pAb |
A7414-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal RIPK1 antibody - middle region |
APR01895G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RIPK1 - middle region. This antibody is tested and proven to work in the following applications: |
Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit |
DLR-RIPK1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit |
DLR-RIPK1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit |
DLR-RIPK1-Ra-48T |
DL Develop |
48T |
EUR 549 |
- Should the Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit |
DLR-RIPK1-Ra-96T |
DL Develop |
96T |
EUR 718 |
- Should the Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit |
RDR-RIPK1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit |
RDR-RIPK1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit |
RDR-RIPK1-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit |
RDR-RIPK1-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit |
RD-RIPK1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit |
RD-RIPK1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit |
RD-RIPK1-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) ELISA Kit |
RD-RIPK1-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
RIPK1 Antibody |
24965-100ul |
SAB |
100ul |
EUR 390 |
RIPK1 antibody |
70R-10453 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal RIPK1 antibody |
RIPK1 antibody |
70R-21675 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal RIPK1 antibody |
RIPK1 Antibody |
44878-100ul |
SAB |
100ul |
EUR 252 |
RIPK1 Antibody |
44878-50ul |
SAB |
50ul |
EUR 187 |
RIPK1 Antibody |
1-CSB-PA618785LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RIPK1. Recognizes RIPK1 from Human, Rat, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:200-1:500 |
Ripk1 Antibody |
1-CSB-PA720181LA01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Ripk1. Recognizes Ripk1 from Mouse, Human. This antibody is Unconjugated. Tested in the following application: ELISA, IP; Recommended dilution: IP:1:200-1:2000 |
RIPK1 Antibody |
DF8234 |
Affbiotech |
200ul |
EUR 304 |
Description: RIPK1 Antibody detects endogenous levels of total RIPK1. |
RIPK1 Antibody |
DF2642 |
Affbiotech |
200ul |
EUR 304 |
Description: RIPK1 antibody detects endogenous levels of total RIPK1. |
RIPK1 Antibody |
AF7588 |
Affbiotech |
200ul |
EUR 376 |
Description: RIPK1 Antibody detects endogenous levels of RIPK1. |
RIPK1 Antibody |
1-CSB-PA019735GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against RIPK1. Recognizes RIPK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
RIPk1 Antibody |
AF7877 |
Affbiotech |
200ul |
EUR 376 |
Description: RIP Antibody detects endogenous levels of RIP. |
Polyclonal RIPK1 / RIP Antibody (N-Terminus) |
APR02641G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RIPK1 / RIP (N-Terminus). This antibody is tested and proven to work in the following applications: |
RIPK1 (Phospho-Tyr284) Polyclonal Conjugated Antibody |
C12953 |
SAB |
100ul |
EUR 397 |
Phospho-RIPK1-S166 Rabbit pAb |
AP1115-100ul |
Abclonal |
100 ul |
EUR 384 |
Phospho-RIPK1-S166 Rabbit pAb |
AP1115-200ul |
Abclonal |
200 ul |
EUR 554 |
Phospho-RIPK1-S166 Rabbit pAb |
AP1115-20ul |
Abclonal |
20 ul |
EUR 183 |
Phospho-RIPK1-S166 Rabbit pAb |
AP1115-50ul |
Abclonal |
50 ul |
EUR 265 |
RIPK1 Conjugated Antibody |
C44878 |
SAB |
100ul |
EUR 397 |
RIPK1-Specific Antibody |
abx237313-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Anti-RIPK1 antibody |
STJ191954 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to RIPK1 |
RIPK1 siRNA |
20-abx931562 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RIPK1 siRNA |
20-abx931563 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RIPK1 (Phospho-Tyr284) Antibody |
12953-100ul |
SAB |
100ul |
EUR 252 |
RIPK1 (Phospho-Tyr284) Antibody |
12953-50ul |
SAB |
50ul |
EUR 187 |
RIPK1 Antibody, HRP conjugated |
1-CSB-PA618785LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RIPK1. Recognizes RIPK1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
RIPK1 Antibody, FITC conjugated |
1-CSB-PA618785LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RIPK1. Recognizes RIPK1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
RIPK1 Antibody, Biotin conjugated |
1-CSB-PA618785LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RIPK1. Recognizes RIPK1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Ripk1 Antibody, HRP conjugated |
1-CSB-PA720181LB01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Ripk1. Recognizes Ripk1 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA |
Ripk1 Antibody, FITC conjugated |
1-CSB-PA720181LC01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Ripk1. Recognizes Ripk1 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA |
Ripk1 Antibody, Biotin conjugated |
1-CSB-PA720181LD01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Ripk1. Recognizes Ripk1 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Phospho-RIPK1 (Ser166) Antibody |
AF2398 |
Affbiotech |
200ul |
EUR 304 |
Description: Phospho-RIP (Ser166) Antibody detects endogenous levels of RIP. |
Phospho-RIPK1(Tyr384) Antibody |
AF7088 |
Affbiotech |
200ul |
EUR 376 |
Description: Phospho-RIPK1(Tyr284) Antibody detects endogenous levels of RIPK1 only when phosphorylated at Tyr284. |
Phospho-RIPk1 (Ser161) Antibody |
AF7377 |
Affbiotech |
200ul |
EUR 376 |
Description: Phospho-RIP (Ser161) Antibody detects endogenous levels of RIP only when phosphorylated at Ser161. |
anti- RIPK1-Specific antibody |
FNab07313 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:200-1:1000
- IP: 1:200-1:1000
- IHC: 1:100-1:400
- IF: 1:10-1:100
- Immunogen: receptor(TNFRSF)-interacting serine-threonine kinase 1
- Uniprot ID: Q13546
- Research Area: Immunology, Signal Transduction, Metabolism
|
Description: Antibody raised against RIPK1-Specific |
Anti-RIP/RIPK1 Antibody |
PA2051 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-RIP/RIPK1 Antibody |
PB9116 |
BosterBio |
100ug/vial |
EUR 294 |
Rabbit Anti-Human RIPK1 monoclonal antibody, clone KK103-19 |
CABT-L850 |
Creative Diagnostics |
100 ul |
EUR 777 |
RIPK1 Blocking Peptide |
33R-8158 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RIPK1 antibody, catalog no. 70R-10453 |
RIPK1 Blocking Peptide |
DF8234-BP |
Affbiotech |
1mg |
EUR 195 |
RIPK1 Blocking Peptide |
DF2642-BP |
Affbiotech |
1mg |
EUR 195 |
RIPK1 Blocking Peptide |
AF7588-BP |
Affbiotech |
1mg |
EUR 195 |
RIPK1 cloning plasmid |
CSB-CL618785HU-10ug |
Cusabio |
10ug |
EUR 674 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2016
- Sequence: atgcaaccagacatgtccttgaatgtcattaagatgaaatccagtgacttcctggagagtgcagaactggacagcggaggcttcgggaaggtgtctctgtgtttccacagaacccagggactcatgatcatgaaaacagtgtacaaggggcccaactgcattgagcacaacgagg
- Show more
|
Description: A cloning plasmid for the RIPK1 gene. |
RIPk1 Blocking Peptide |
AF7877-BP |
Affbiotech |
1mg |
EUR 195 |
Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Polyclonal Antibody (Human) |
4-PAE640Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RIPK1 (Phe17~Tyr289)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1) |
Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Polyclonal Antibody (Rat) |
4-PAE640Ra01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RIPK1 (Met1~Ala179)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1) |
Mouse RIPK1 shRNA Plasmid |
20-abx972462 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human RIPK1 shRNA Plasmid |
20-abx955755 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Polyclonal Antibody (Human), APC |
4-PAE640Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RIPK1 (Phe17~Tyr289)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1). This antibody is labeled with APC. |
Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Polyclonal Antibody (Human), Biotinylated |
4-PAE640Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RIPK1 (Phe17~Tyr289)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1). This antibody is labeled with Biotin. |
Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Polyclonal Antibody (Human), Cy3 |
4-PAE640Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RIPK1 (Phe17~Tyr289)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1). This antibody is labeled with Cy3. |
Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Polyclonal Antibody (Human), FITC |
4-PAE640Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RIPK1 (Phe17~Tyr289)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1). This antibody is labeled with FITC. |
Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Polyclonal Antibody (Human), HRP |
4-PAE640Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RIPK1 (Phe17~Tyr289)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1). This antibody is labeled with HRP. |
Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Polyclonal Antibody (Human), PE |
4-PAE640Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RIPK1 (Phe17~Tyr289)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1). This antibody is labeled with PE. |
Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Polyclonal Antibody (Rat), APC |
4-PAE640Ra01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RIPK1 (Met1~Ala179)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1). This antibody is labeled with APC. |
Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Polyclonal Antibody (Rat), Biotinylated |
4-PAE640Ra01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RIPK1 (Met1~Ala179)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1). This antibody is labeled with Biotin. |
Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Polyclonal Antibody (Rat), Cy3 |
4-PAE640Ra01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RIPK1 (Met1~Ala179)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1). This antibody is labeled with Cy3. |
Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Polyclonal Antibody (Rat), FITC |
4-PAE640Ra01-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RIPK1 (Met1~Ala179)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1). This antibody is labeled with FITC. |
Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Polyclonal Antibody (Rat), HRP |
4-PAE640Ra01-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RIPK1 (Met1~Ala179)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1). This antibody is labeled with HRP. |
Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Polyclonal Antibody (Rat), PE |
4-PAE640Ra01-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RIPK1 (Met1~Ala179)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1). This antibody is labeled with PE. |
Phospho-RIPK1 (Ser166) Blocking Peptide |
AF2398-BP |
Affbiotech |
1mg |
EUR 195 |
Phospho-RIPK1(Tyr384) Blocking Peptide |
AF7088-BP |
Affbiotech |
1mg |
EUR 195 |
Phospho-RIPk1 (Ser161) Blocking Peptide |
AF7377-BP |
Affbiotech |
1mg |
EUR 195 |
Ripk1 ORF Vector (Rat) (pORF) |
ORF075392 |
ABM |
1.0 ug DNA |
EUR 506 |
h RIPK1 inducible lentiviral particles |
LVP786 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
Description: Pre-made over-expression lentivirus for expressing human target: RIPK1 (receptor (TNFRSF)-interacting serine-threonine kinase 1 ), [alternative names: RIP; RIP1]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_003804.3. It also contains a RFP-Blasticidin dual selection marker. |
RIPK1 ORF Vector (Human) (pORF) |
ORF028956 |
ABM |
1.0 ug DNA |
EUR 95 |
Ripk1 ORF Vector (Mouse) (pORF) |
ORF056094 |
ABM |
1.0 ug DNA |
EUR 506 |
RIPK1 ELISA Kit (Human) (OKAN06497) |
OKAN06497 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases. The encoded protein plays a role in inflammation and cell death in response to tissue damage, pathogen recognition, and as part of developmental regulation. RIPK1/RIPK3 kinase-mediated necrosis is referred to as necroptosis. Genetic disruption of this gene in mice results in death shortly after birth.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.063 ng/mL |
RIPK1 ELISA Kit (Mouse) (OKCA01762) |
OKCA01762 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
Description: Description of target: Serine-threonine kinase which transduces inflammatory and cell-death signals (programmed necrosis) following death receptors ligation, activation of pathogen recognition receptors (PRRs), and DNA damage. Upon activation of TNFR1 by the TNF-alpha family cytokines, TRADD and TRAF2 are recruited to the receptor. Phosphorylates DAB2IP at 'Ser-728' in a TNF-alpha-dependent manner, and thereby activates the MAP3K5-JNK apoptotic cascade. Ubiquitination by TRAF2 via 'Lys-63'-link chains acts as a critical enhancer of communication with downstream signal transducers in the mitogen-activated protein kinase pathway and the NF-kappa-B pathway, which in turn mediate downstream events including the activation of genes encoding inflammatory molecules. Polyubiquitinated protein binds to IKBKG/NEMO, the regulatory subunit of the IKK complex, a critical event for NF-kappa-B activation. Interaction with other cellular RHIM-containing adapters initiates gene activation and cell death. RIPK1 and RIPK3 association, in particular, forms a necrosis-inducing complex. Interacts with ARHGEF2.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 3.9 ng/mL |
RIPK1 ELISA Kit (Human) (OKCD00436) |
OKCD00436 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Serine-threonine kinase which transduces inflammatory and cell-death signals (programmed necrosis) following death receptors ligation, activation of pathogen recognition receptors (PRRs), and DNA damage. Upon activation of TNFR1 by the TNF-alpha family cytokines, TRADD and TRAF2 are recruited to the receptor. Phosphorylates DAB2IP at 'Ser-728' in a TNF-alpha-dependent manner, and thereby activates the MAP3K5-JNK apoptotic cascade. Ubiquitination by TRAF2 via 'Lys-63'-link chains acts as a critical enhancer of communication with downstream signal transducers in the mitogen-activated protein kinase pathway and the NF-kappa-B pathway, which in turn mediate downstream events including the activation of genes encoding inflammatory molecules. Polyubiquitinated protein binds to IKBKG/NEMO, the regulatory subunit of the IKK complex, a critical event for NF-kappa-B activation. Interaction with other cellular RHIM-containing adapters initiates gene activation and cell death. RIPK1 and RIPK3 association, in particular, forms a necrosis-inducing complex.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.063 ng/mL |
RIPK1 ELISA Kit (Rat) (OKCD00437) |
OKCD00437 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.055 ng/mL |
RIPK1 ELISA Kit (Human) (OKDD00507) |
OKDD00507 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.057 ng/mL |
Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Polyclonal Antibody (Human), APC-Cy7 |
4-PAE640Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RIPK1 (Phe17~Tyr289)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Receptor Interacting Serine Threonine Kinase 1 (RIPK1). This antibody is labeled with APC-Cy7. |
Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAE640Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RIPK1 (Met1~Ala179)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 1 (RIPK1). This antibody is labeled with APC-Cy7. |
Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Antibody |
20-abx007191 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Antibody |
abx027672-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Antibody |
abx027672-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Antibody |
20-abx115084 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Antibody |
20-abx128294 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Antibody |
20-abx131543 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Antibody |
abx145080-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Antibody |
20-abx146747 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Antibody |
20-abx174346 |
Abbexa |
|
|
|
Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Antibody |
20-abx174347 |
Abbexa |
|
|
|
Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Antibody |
20-abx338927 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Receptor Interacting Serine Threonine Kinase 1 (Ripk1) Antibody |
20-abx300043 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Monoclonal RIPK1 / RIP Antibody (clone 7H10), Clone: 7H10 |
AMM02144G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A Monoclonal antibody against Human RIPK1 / RIP (clone 7H10). The antibodies are raised in Mouse and are from clone 7H10. This antibody is applicable in WB and IHC-P, IP |
Monoclonal RIPK1 / RIP Antibody (clone 2G3), Clone: 2G3 |
AMM02298G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A Monoclonal antibody against Human RIPK1 / RIP (clone 2G3). The antibodies are raised in Mouse and are from clone 2G3. This antibody is applicable in WB and IHC-P |
Ripk1 sgRNA CRISPR Lentivector set (Mouse) |
K5037801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ripk1 sgRNA CRISPR Lentivector set (Rat) |
K6746301 |
ABM |
3 x 1.0 ug |
EUR 339 |
RIPK1 sgRNA CRISPR Lentivector set (Human) |
K1825801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Antibody (HRP) |
20-abx337447 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Antibody (FITC) |
20-abx337448 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Receptor Interacting Serine Threonine Kinase 1 (RIPK1) Antibody (Biotin) |
20-abx337449 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Receptor Interacting Serine Threonine Kinase 1 (Ripk1) Antibody (HRP) |
20-abx300040 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Receptor Interacting Serine Threonine Kinase 1 (Ripk1) Antibody (FITC) |
20-abx300041 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Receptor Interacting Serine Threonine Kinase 1 (Ripk1) Antibody (Biotin) |
20-abx300042 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
CASP2 And RIPK1 Domain Containing Adaptor With Death Domain Protein (CRADD) Polyclonal Antibody (Human) |
4-PAL376Hu01 |
Cloud-Clone |
-
EUR 262.00
-
EUR 2747.00
-
EUR 679.00
-
EUR 331.00
-
EUR 220.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CRADD (Met1~Glu199)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human CASP2 And RIPK1 Domain Containing Adaptor With Death Domain Protein (CRADD) |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
RIPK1 Rabbit Polyclonal Antibody