RIPK3 Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
RIPK3 Polyclonal Antibody |
ABP60181-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human RIPK3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of RIPK3 from Human. This RIPK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIPK3 protein |
RIPK3 Polyclonal Antibody |
ABP60181-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human RIPK3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of RIPK3 from Human. This RIPK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RIPK3 protein |
RIPK3 Polyclonal Antibody |
A60610 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
RIPK3 Rabbit pAb |
A12996-100ul |
Abclonal |
100 ul |
EUR 308 |
RIPK3 Rabbit pAb |
A12996-200ul |
Abclonal |
200 ul |
EUR 459 |
RIPK3 Rabbit pAb |
A12996-20ul |
Abclonal |
20 ul |
EUR 183 |
RIPK3 Rabbit pAb |
A12996-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal RIPK3 Antibody (C-term) |
APR03974G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RIPK3 (C-term). This antibody is tested and proven to work in the following applications: |
RIPK3 Polyclonal Antibody, Biotin Conjugated |
A60611 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
RIPK3 Polyclonal Antibody, FITC Conjugated |
A60612 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
RIPK3 Polyclonal Antibody, HRP Conjugated |
A60613 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
RIPK3 Antibody |
AF4808 |
Affbiotech |
200ul |
EUR 376 |
Description: RIPK3 Antibody detects endogenous levels of RIPK3. |
RIPK3 antibody |
38654-100ul |
SAB |
100ul |
EUR 252 |
RIPK3 antibody |
20R-1514 |
Fitzgerald |
100 ug |
EUR 673 |
Description: Rabbit polyclonal RIPK3 antibody |
RIPK3 antibody |
70R-19905 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal RIPK3 antibody |
RIPK3 Antibody |
DF7339 |
Affbiotech |
200ul |
EUR 304 |
Description: RIPK3 Antibody detects endogenous levels of total RIPK3. |
RIPK3 Antibody |
1-CSB-PA897497ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against RIPK3. Recognizes RIPK3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
RIPK3 Antibody |
1-CSB-PA897497LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RIPK3. Recognizes RIPK3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:200-1:500 |
RIPK3 Antibody |
DF10141 |
Affbiotech |
200ul |
EUR 304 |
Description: RIPK3 Antibody detects endogenous levels of total RIPK3. |
RIPK3 Antibody |
1-CSB-PA019737GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against RIPK3. Recognizes RIPK3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Human Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit |
DLR-RIPK3-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Receptor Interacting Serine Threonine Kinase 3 (RIPK3) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit |
DLR-RIPK3-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Receptor Interacting Serine Threonine Kinase 3 (RIPK3) in samples from tissue homogenates, cell lysates or other biological fluids. |
Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit |
DLR-RIPK3-Ra-48T |
DL Develop |
48T |
EUR 549 |
- Should the Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3) in samples from tissue homogenates, cell lysates or other biological fluids. |
Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit |
DLR-RIPK3-Ra-96T |
DL Develop |
96T |
EUR 718 |
- Should the Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit |
RD-RIPK3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit |
RD-RIPK3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit |
RD-RIPK3-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit |
RD-RIPK3-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
Human Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit |
RDR-RIPK3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit |
RDR-RIPK3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit |
RDR-RIPK3-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3) ELISA Kit |
RDR-RIPK3-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
Polyclonal RIPK3 antibody - N-terminal region |
APR00553G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RIPK3 - N-terminal region. This antibody is tested and proven to work in the following applications: |
Polyclonal RIPK3 / RIP3 Antibody (aa480-530) |
APR02432G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RIPK3 / RIP3 (aa480-530). This antibody is tested and proven to work in the following applications: |
RIPK3 Conjugated Antibody |
C38654 |
SAB |
100ul |
EUR 397 |
Anti-RIPK3 antibody |
STJ27384 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The product of this gene is a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases, and contains a C-terminal domain unique from other RIP family members. The encoded protein is predominantly localized to the cytoplasm, and can undergo nucleocytoplasmic shuttling dependent on novel nuclear localization and export signals. It is a component of the tumor necrosis factor (TNF) receptor-I signaling complex, and can induce apoptosis and weakly activate the NF-kappaB transcription factor. |
Anti-RIPK3 antibody |
STJ114965 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The product of this gene is a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases, and contains a C-terminal domain unique from other RIP family members. The encoded protein is predominantly localized to the cytoplasm, and can undergo nucleocytoplasmic shuttling dependent on novel nuclear localization and export signals. It is a component of the tumor necrosis factor (TNF) receptor-I signaling complex, and can induce apoptosis and weakly activate the NF-kappaB transcription factor. |
Anti-RIPK3 antibody |
STJ191986 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to RIPK3 |
RIPK3 siRNA |
20-abx904586 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RIPK3 siRNA |
20-abx931566 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RIPK3 siRNA |
20-abx931567 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Phospho-RIPK3(Ser316) Antibody |
AF4508 |
Affbiotech |
200ul |
EUR 376 |
Description: Phospho-RIPK3(Ser316) Antibody detects endogenous levels of RIPK3 only when phosphorylated at Ser316. |
RIPK3 Antibody, HRP conjugated |
1-CSB-PA897497LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RIPK3. Recognizes RIPK3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
RIPK3 Antibody, FITC conjugated |
1-CSB-PA897497LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RIPK3. Recognizes RIPK3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
RIPK3 Antibody, Biotin conjugated |
1-CSB-PA897497LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RIPK3. Recognizes RIPK3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Anti-RIP3/RIPK3 Antibody |
PA2242 |
BosterBio |
100ug/vial |
EUR 294 |
RIPK3 Blocking Peptide |
AF4808-BP |
Affbiotech |
1mg |
EUR 195 |
RIPK3 Blocking Peptide |
20-abx161414 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RIPK3 Blocking Peptide |
DF7339-BP |
Affbiotech |
1mg |
EUR 195 |
RIPK3 Blocking Peptide |
DF10141-BP |
Affbiotech |
1mg |
EUR 195 |
RIPK3 cloning plasmid |
CSB-CL897497HU-10ug |
Cusabio |
10ug |
EUR 255 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 522
- Sequence: atgtcgtgcgtcaagttatggcccagcggtgcccccgcccccttggtgtccatcgaggaactggagaaccaggagctcgtcggcaaaggcgggttcggcacagtgttccgggcgcaacataggaagtggggctacgatgtggcggtcaagatcgtaaactcgaaggcgatatccag
- Show more
|
Description: A cloning plasmid for the RIPK3 gene. |
Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Mouse) |
4-PAE639Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RIPK3 (Leu16~Cys239)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Receptor Interacting Serine Threonine Kinase 3 (RIPK3) |
Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Rat) |
4-PAE639Ra01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RIPK3 (Val50~Pro272)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3) |
Mouse RIPK3 shRNA Plasmid |
20-abx974829 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat RIPK3 shRNA Plasmid |
20-abx987959 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human RIPK3 shRNA Plasmid |
20-abx957541 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Mouse), APC |
4-PAE639Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RIPK3 (Leu16~Cys239)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with APC. |
Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Mouse), Biotinylated |
4-PAE639Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RIPK3 (Leu16~Cys239)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with Biotin. |
Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Mouse), Cy3 |
4-PAE639Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RIPK3 (Leu16~Cys239)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with Cy3. |
Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Mouse), FITC |
4-PAE639Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RIPK3 (Leu16~Cys239)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with FITC. |
Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Mouse), HRP |
4-PAE639Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RIPK3 (Leu16~Cys239)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with HRP. |
Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Mouse), PE |
4-PAE639Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RIPK3 (Leu16~Cys239)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with PE. |
Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Rat), APC |
4-PAE639Ra01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RIPK3 (Val50~Pro272)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with APC. |
Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Rat), Biotinylated |
4-PAE639Ra01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RIPK3 (Val50~Pro272)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with Biotin. |
Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Rat), Cy3 |
4-PAE639Ra01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RIPK3 (Val50~Pro272)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with Cy3. |
Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Rat), FITC |
4-PAE639Ra01-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RIPK3 (Val50~Pro272)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with FITC. |
Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Rat), HRP |
4-PAE639Ra01-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RIPK3 (Val50~Pro272)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with HRP. |
Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Rat), PE |
4-PAE639Ra01-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RIPK3 (Val50~Pro272)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with PE. |
Phospho-RIPK3(Ser316) Blocking Peptide |
AF4508-BP |
Affbiotech |
1mg |
EUR 195 |
RIPK3 ORF Vector (Human) (pORF) |
ORF008829 |
ABM |
1.0 ug DNA |
EUR 95 |
Ripk3 ORF Vector (Mouse) (pORF) |
ORF056096 |
ABM |
1.0 ug DNA |
EUR 506 |
Ripk3 ORF Vector (Mouse) (pORF) |
ORF056097 |
ABM |
1.0 ug DNA |
EUR 506 |
Ripk3 ORF Vector (Mouse) (pORF) |
ORF056098 |
ABM |
1.0 ug DNA |
EUR 506 |
Ripk3 ORF Vector (Rat) (pORF) |
ORF075394 |
ABM |
1.0 ug DNA |
EUR 506 |
RIPK3 ELISA Kit (Rat) (OKAN06271) |
OKAN06271 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: a putative homocysteine respondent protein [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.061 ng/mL |
RIPK3 ELISA Kit (Human) (OKAN06325) |
OKAN06325 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: The product of this gene is a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases, and contains a C-terminal domain unique from other RIP family members. The encoded protein is predominantly localized to the cytoplasm, and can undergo nucleocytoplasmic shuttling dependent on novel nuclear localization and export signals. It is a component of the tumor necrosis factor (TNF) receptor-I signaling complex, and can induce apoptosis and weakly activate the NF-kappaB transcription factor.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.122 ng/mL |
RIPK3 ELISA Kit (Human) (OKCD02850) |
OKCD02850 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Essential for necroptosis, a programmed cell death process in response to death-inducing TNF-alpha family members. Upon induction of necrosis, RIPK3 interacts with, and phosphorylates RIPK1 and MLKL to form a necrosis-inducing complex. RIPK3 binds to and enhances the activity of three metabolic enzymes: GLUL, GLUD1, and PYGL. These metabolic enzymes may eventually stimulate the tricarboxylic acid cycle and oxidative phosphorylation, which could result in enhanced ROS production.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.122 ng/mL |
RIPK3 ELISA Kit (Mouse) (OKCD02851) |
OKCD02851 |
Aviva Systems Biology |
96 Wells |
EUR 857 |
Description: Description of target: Essential for necroptosis, a programmed cell death process in response to death-inducing TNF-alpha family members. Upon induction of necrosis, RIPK3 interacts with, and phosphorylates RIPK1 and MLKL to form a necrosis-inducing complex. RIPK3 binds to and enhances the activity of three metabolic enzymes: GLUL, GLUD1, and PYGL. These metabolic enzymes may eventually stimulate the tricarboxylic acid cycle and oxidative phosphorylation, which could result in enhanced ROS production.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.119 ng/mL |
RIPK3 ELISA Kit (Human) (OKCA02138) |
OKCA02138 |
Aviva Systems Biology |
96 Wells |
EUR 833 |
Description: Description of target: Essential for necroptosis, a programmed cell death process in response to death-inducing TNF-alpha family members. Upon induction of necrosis, RIPK3 interacts with, and phosphorylates RIPK1 and MLKL to form a necrosis-inducing complex. RIPK3 binds to and enhances the activity of three metabolic enzymes: GLUL, GLUD1, and PYGL. These metabolic enzymes may eventually stimulate the tricarboxylic acid cycle and oxidative phosphorylation, which could result in enhanced ROS production.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.9 pg/mL |
RIPK3 ELISA Kit (Rat) (OKCD08674) |
OKCD08674 |
Aviva Systems Biology |
96 Wells |
EUR 1053 |
Description: Description of target: a putative homocysteine respondent protein.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.061ng/mL |
RIPK3 ELISA Kit (Human) (OKEH07133) |
OKEH07133 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: Essential for necroptosis, a programmed cell death process in response to death-inducing TNF-alpha family members. Upon induction of necrosis, RIPK3 interacts with, and phosphorylates RIPK1 and MLKL to form a necrosis-inducing complex. RIPK3 binds to and enhances the activity of three metabolic enzymes: GLUL, GLUD1, and PYGL. These metabolic enzymes may eventually stimulate the tricarboxylic acid cycle and oxidative phosphorylation, which could result in enhanced ROS production.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.086 ng/mL |
Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAE639Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RIPK3 (Leu16~Cys239)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with APC-Cy7. |
Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAE639Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RIPK3 (Val50~Pro272)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Receptor Interacting Serine Threonine Kinase 3 (RIPK3). This antibody is labeled with APC-Cy7. |
Receptor-Interacting Serine-Threonine Kinase 3 (RIPK3) Antibody |
20-abx115091 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Antibody |
20-abx121704 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Antibody |
20-abx000804 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Antibody |
abx038228-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Antibody |
20-abx104444 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Antibody |
20-abx104445 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Antibody |
20-abx004160 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Antibody |
20-abx174348 |
Abbexa |
|
|
|
Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Antibody |
20-abx174349 |
Abbexa |
-
EUR 356.00
-
EUR 913.00
-
EUR 467.00
-
EUR 154.00
-
EUR 272.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Antibody |
20-abx178226 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Antibody |
20-abx320360 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Antibody |
20-abx301766 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
RIPK3 sgRNA CRISPR Lentivector set (Human) |
K1826001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ripk3 sgRNA CRISPR Lentivector set (Mouse) |
K3734101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ripk3 sgRNA CRISPR Lentivector set (Rat) |
K7299301 |
ABM |
3 x 1.0 ug |
EUR 339 |
h RIPK3 (6His) inducible lentiviral particles |
LVP856 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
Description: Pre-made over-expression lentivirus for expressing human target: h RIPK3 (6His) (receptor-interacting serine-threonine kinase 3), [alternative names: RIP3]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_006871.3. It also contains a RFP-Blasticidin dual selection marker. |
Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Antibody (HRP) |
20-abx312526 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Antibody (FITC) |
20-abx312527 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Receptor Interacting Serine Threonine Kinase 3 (RIPK3) Antibody (Biotin) |
20-abx312528 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
RIPK3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1826002 |
ABM |
1.0 ug DNA |
EUR 154 |
RIPK3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1826003 |
ABM |
1.0 ug DNA |
EUR 154 |
RIPK3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1826004 |
ABM |
1.0 ug DNA |
EUR 154 |
Ripk3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3734102 |
ABM |
1.0 ug DNA |
EUR 154 |
Ripk3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3734103 |
ABM |
1.0 ug DNA |
EUR 154 |
Ripk3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3734104 |
ABM |
1.0 ug DNA |
EUR 154 |
Ripk3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7299302 |
ABM |
1.0 ug DNA |
EUR 154 |
Ripk3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7299303 |
ABM |
1.0 ug DNA |
EUR 154 |
Ripk3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7299304 |
ABM |
1.0 ug DNA |
EUR 154 |
RIPK3 Protein Vector (Human) (pPB-C-His) |
PV035313 |
ABM |
500 ng |
EUR 329 |
RIPK3 Protein Vector (Human) (pPB-N-His) |
PV035314 |
ABM |
500 ng |
EUR 329 |
RIPK3 Protein Vector (Human) (pPM-C-HA) |
PV035315 |
ABM |
500 ng |
EUR 329 |
RIPK3 Protein Vector (Human) (pPM-C-His) |
PV035316 |
ABM |
500 ng |
EUR 329 |
Recombinant Mouse Ripk3 Protein, His, Yeast-100ug |
QP9919-ye-100ug |
EnQuireBio |
100ug |
EUR 571 |
Recombinant Mouse Ripk3 Protein, His, Yeast-10ug |
QP9919-ye-10ug |
EnQuireBio |
10ug |
EUR 272 |
Recombinant Mouse Ripk3 Protein, His, Yeast-1mg |
QP9919-ye-1mg |
EnQuireBio |
1mg |
EUR 2303 |
Recombinant Mouse Ripk3 Protein, His, Yeast-200ug |
QP9919-ye-200ug |
EnQuireBio |
200ug |
EUR 898 |
Recombinant Mouse Ripk3 Protein, His, Yeast-500ug |
QP9919-ye-500ug |
EnQuireBio |
500ug |
EUR 1505 |
Recombinant Mouse Ripk3 Protein, His, Yeast-50ug |
QP9919-ye-50ug |
EnQuireBio |
50ug |
EUR 354 |
Recombinant Human Ripk3 Protein, His, Baculovirus-100ug |
QP9945-ba-100ug |
EnQuireBio |
100ug |
EUR 1260 |
Recombinant Human Ripk3 Protein, His, Baculovirus-20ug |
QP9945-ba-20ug |
EnQuireBio |
20ug |
EUR 489 |
Recombinant Human Ripk3 Protein, His, Baculovirus-50ug |
QP9945-ba-50ug |
EnQuireBio |
50ug |
EUR 915 |
Recombinant Human Ripk3 Protein, His, Yeast-100ug |
QP9945-ye-100ug |
EnQuireBio |
100ug |
EUR 480 |
Recombinant Human Ripk3 Protein, His, Yeast-10ug |
QP9945-ye-10ug |
EnQuireBio |
10ug |
EUR 236 |
Recombinant Human Ripk3 Protein, His, Yeast-1mg |
QP9945-ye-1mg |
EnQuireBio |
1mg |
EUR 1885 |
Recombinant Human Ripk3 Protein, His, Yeast-200ug |
QP9945-ye-200ug |
EnQuireBio |
200ug |
EUR 744 |
Recombinant Human Ripk3 Protein, His, Yeast-500ug |
QP9945-ye-500ug |
EnQuireBio |
500ug |
EUR 1206 |
Recombinant Human Ripk3 Protein, His, Yeast-50ug |
QP9945-ye-50ug |
EnQuireBio |
50ug |
EUR 299 |
RIPK3 Protein Vector (Rat) (pPB-C-His) |
PV301574 |
ABM |
500 ng |
EUR 603 |
RIPK3 Protein Vector (Rat) (pPB-N-His) |
PV301575 |
ABM |
500 ng |
EUR 603 |
RIPK3 Protein Vector (Rat) (pPM-C-HA) |
PV301576 |
ABM |
500 ng |
EUR 603 |
RIPK3 Protein Vector (Rat) (pPM-C-His) |
PV301577 |
ABM |
500 ng |
EUR 603 |
RIPK3 Protein Vector (Mouse) (pPB-C-His) |
PV224382 |
ABM |
500 ng |
EUR 603 |
RIPK3 Protein Vector (Mouse) (pPB-N-His) |
PV224383 |
ABM |
500 ng |
EUR 603 |
RIPK3 Protein Vector (Mouse) (pPM-C-HA) |
PV224384 |
ABM |
500 ng |
EUR 603 |
RIPK3 Protein Vector (Mouse) (pPM-C-His) |
PV224385 |
ABM |
500 ng |
EUR 603 |
RIPK3 Protein Vector (Mouse) (pPB-C-His) |
PV224386 |
ABM |
500 ng |
EUR 603 |
RIPK3 Protein Vector (Mouse) (pPB-N-His) |
PV224387 |
ABM |
500 ng |
EUR 603 |
RIPK3 Protein Vector (Mouse) (pPM-C-HA) |
PV224388 |
ABM |
500 ng |
EUR 603 |
RIPK3 Protein Vector (Mouse) (pPM-C-His) |
PV224389 |
ABM |
500 ng |
EUR 603 |
RIPK3 Protein Vector (Mouse) (pPB-C-His) |
PV224390 |
ABM |
500 ng |
EUR 603 |
RIPK3 Protein Vector (Mouse) (pPB-N-His) |
PV224391 |
ABM |
500 ng |
EUR 603 |
RIPK3 Protein Vector (Mouse) (pPM-C-HA) |
PV224392 |
ABM |
500 ng |
EUR 603 |
RIPK3 Protein Vector (Mouse) (pPM-C-His) |
PV224393 |
ABM |
500 ng |
EUR 603 |
Ripk3 3'UTR GFP Stable Cell Line |
TU167905 |
ABM |
1.0 ml |
Ask for price |
RIPK3 3'UTR Luciferase Stable Cell Line |
TU019938 |
ABM |
1.0 ml |
EUR 1394 |
Ripk3 3'UTR Luciferase Stable Cell Line |
TU117905 |
ABM |
1.0 ml |
Ask for price |
RIPK3 3'UTR GFP Stable Cell Line |
TU069938 |
ABM |
1.0 ml |
EUR 1394 |
Ripk3 3'UTR Luciferase Stable Cell Line |
TU219458 |
ABM |
1.0 ml |
Ask for price |
Ripk3 3'UTR GFP Stable Cell Line |
TU269458 |
ABM |
1.0 ml |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
RIPK3 Rabbit Polyclonal Antibody