RTDR1 Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
RTDR1 Polyclonal Antibody |
ES10667-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against RTDR1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RTDR1 Polyclonal Antibody |
ES10667-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against RTDR1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RTDR1 Antibody |
44506-100ul |
SAB |
100ul |
EUR 252 |
RTDR1 Antibody |
44506-50ul |
SAB |
50ul |
EUR 187 |
RTDR1 Antibody |
DF10086 |
Affbiotech |
200ul |
EUR 304 |
Description: RTDR1 Antibody detects endogenous levels of total RTDR1. |
RTDR1 antibody |
70R-3551 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal RTDR1 antibody raised against the middle region of RTDR1 |
RTDR1 antibody |
70R-3433 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal RTDR1 antibody raised against the N terminal of RTDR1 |
RTDR1 Antibody |
20-abx121216 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Polyclonal RTDR1 Antibody (N-term) |
APR03795G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RTDR1 (N-term). This antibody is tested and proven to work in the following applications: |
RTDR1 Conjugated Antibody |
C44506 |
SAB |
100ul |
EUR 397 |
Anti-RTDR1 antibody |
STJ191825 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to RTDR1 |
RTDR1 siRNA |
20-abx932235 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-RTDR1 |
YF-PA18397 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to RTDR1 |
RTDR1 Blocking Peptide |
33R-3896 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RTDR1 antibody, catalog no. 70R-3551 |
RTDR1 Blocking Peptide |
33R-5675 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RTDR1 antibody, catalog no. 70R-3433 |
RTDR1 Blocking Peptide |
DF10086-BP |
Affbiotech |
1mg |
EUR 195 |
RTDR1 Blocking Peptide |
20-abx161216 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RTDR1 cloning plasmid |
CSB-CL887042HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1047
- Sequence: atggcccattcccagaactccttggagcttcccattaacatcaatgccacccagattaccactgcctatggccatcgggccctgcccaagctgaaggaggagctgcagtcagaggacctccagacgaggcagaaagccctcatggccctgtgtgacctcatgcatgaccccgagt
- Show more
|
Description: A cloning plasmid for the RTDR1 gene. |
Anti-RTDR1 (3B6) |
YF-MA18170 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to RTDR1 |
Human RTDR1 shRNA Plasmid |
20-abx958999 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
RTDR1 Recombinant Protein (Human) |
RP027370 |
ABM |
100 ug |
Ask for price |
RTDR1 Recombinant Protein (Rat) |
RP227207 |
ABM |
100 ug |
Ask for price |
RTDR1 Recombinant Protein (Mouse) |
RP169520 |
ABM |
100 ug |
Ask for price |
RTDR1 Recombinant Protein (Mouse) |
RP169523 |
ABM |
100 ug |
Ask for price |
RTDR1 Recombinant Protein (Mouse) |
RP169526 |
ABM |
100 ug |
Ask for price |
RTDR1 Recombinant Protein (Mouse) |
RP169529 |
ABM |
100 ug |
Ask for price |
Rtdr1 ORF Vector (Rat) (pORF) |
ORF075737 |
ABM |
1.0 ug DNA |
EUR 506 |
RTDR1 ORF Vector (Human) (pORF) |
ORF009124 |
ABM |
1.0 ug DNA |
EUR 95 |
Rtdr1 ORF Vector (Mouse) (pORF) |
ORF056508 |
ABM |
1.0 ug DNA |
EUR 506 |
Rtdr1 ORF Vector (Mouse) (pORF) |
ORF056509 |
ABM |
1.0 ug DNA |
EUR 506 |
Rtdr1 ORF Vector (Mouse) (pORF) |
ORF056510 |
ABM |
1.0 ug DNA |
EUR 506 |
Rtdr1 ORF Vector (Mouse) (pORF) |
ORF056511 |
ABM |
1.0 ug DNA |
EUR 506 |
Rhabdoid Tumor Deletion Region Protein 1 (RTDR1) Antibody |
abx027299-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Rhabdoid Tumor Deletion Region Protein 1 (RTDR1) Antibody |
abx027299-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Rhabdoid Tumor Deletion Region Protein 1 (RTDR1) Antibody |
20-abx218401 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Rtdr1 sgRNA CRISPR Lentivector set (Rat) |
K6042501 |
ABM |
3 x 1.0 ug |
EUR 339 |
RTDR1 Rabbit Polyclonal Antibody