STRN3 Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
STRN3 Polyclonal Antibody |
ABP60547-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human STRN3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of STRN3 from Human, Mouse, Rat. This STRN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STRN3 protein |
STRN3 Polyclonal Antibody |
ABP60547-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human STRN3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of STRN3 from Human, Mouse, Rat. This STRN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STRN3 protein |
STRN3 Polyclonal Antibody |
ABP60547-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human STRN3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of STRN3 from Human, Mouse, Rat. This STRN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STRN3 protein |
STRN3 Rabbit pAb |
A12586-100ul |
Abclonal |
100 ul |
EUR 308 |
STRN3 Rabbit pAb |
A12586-200ul |
Abclonal |
200 ul |
EUR 459 |
STRN3 Rabbit pAb |
A12586-20ul |
Abclonal |
20 ul |
EUR 183 |
STRN3 Rabbit pAb |
A12586-50ul |
Abclonal |
50 ul |
EUR 223 |
STRN3 Rabbit pAb |
A6756-100ul |
Abclonal |
100 ul |
EUR 308 |
STRN3 Rabbit pAb |
A6756-200ul |
Abclonal |
200 ul |
EUR 459 |
STRN3 Rabbit pAb |
A6756-20ul |
Abclonal |
20 ul |
EUR 183 |
STRN3 Rabbit pAb |
A6756-50ul |
Abclonal |
50 ul |
EUR 223 |
STRN3 antibody |
39154-100ul |
SAB |
100ul |
EUR 252 |
STRN3 Conjugated Antibody |
C39154 |
SAB |
100ul |
EUR 397 |
Anti-STRN3 antibody |
STJ191908 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to STRN3 |
STRN3 siRNA |
20-abx905346 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
STRN3 siRNA |
20-abx935544 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
STRN3 siRNA |
20-abx935545 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Striatin-3 (STRN3) Antibody |
20-abx005180 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
STRN3 cloning plasmid |
CSB-CL614388HU1-10ug |
Cusabio |
10ug |
EUR 709 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2142
- Sequence: atggacgagcttgccggaggcggtggtggcggcccggggatggcggcccctccccggcagcagcagggacctggggggaacctgggcctttcgcccggggggaacggagcggcgggcggcgggggtcctccggcctccgagggagcgggtcccgcggcaggccccgagctgtccc
- Show more
|
Description: A cloning plasmid for the STRN3 gene. |
STRN3 cloning plasmid |
CSB-CL614388HU2-10ug |
Cusabio |
10ug |
EUR 709 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2142
- Sequence: atggacgagcttgccggaggcggtggtggcggcccggggatggcggcccctccccggcagcagcagggacctggggggaacctgggcctttcgcccggggggaacggagcggcgggcggcgggggtcctccggcctccgagggagcgggtcccgcggcaggccccgagctgtccc
- Show more
|
Description: A cloning plasmid for the STRN3 gene. |
Mouse STRN3 shRNA Plasmid |
20-abx979284 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat STRN3 shRNA Plasmid |
20-abx987202 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human STRN3 shRNA Plasmid |
20-abx959304 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
STRN3 Recombinant Protein (Human) |
RP043831 |
ABM |
100 ug |
Ask for price |
STRN3 Recombinant Protein (Human) |
RP043834 |
ABM |
100 ug |
Ask for price |
STRN3 Recombinant Protein (Rat) |
RP231551 |
ABM |
100 ug |
Ask for price |
STRN3 Recombinant Protein (Mouse) |
RP176195 |
ABM |
100 ug |
Ask for price |
STRN3 Recombinant Protein (Mouse) |
RP176198 |
ABM |
100 ug |
Ask for price |
Strn3 ORF Vector (Mouse) (pORF) |
ORF058733 |
ABM |
1.0 ug DNA |
EUR 506 |
Strn3 ORF Vector (Mouse) (pORF) |
ORF058734 |
ABM |
1.0 ug DNA |
EUR 506 |
Strn3 ORF Vector (Rat) (pORF) |
ORF077185 |
ABM |
1.0 ug DNA |
EUR 506 |
STRN3 ORF Vector (Human) (pORF) |
ORF014611 |
ABM |
1.0 ug DNA |
EUR 354 |
STRN3 ORF Vector (Human) (pORF) |
ORF014612 |
ABM |
1.0 ug DNA |
EUR 354 |
STRN3 sgRNA CRISPR Lentivector set (Human) |
K2307401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Strn3 sgRNA CRISPR Lentivector set (Mouse) |
K4874301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Strn3 sgRNA CRISPR Lentivector set (Rat) |
K7109501 |
ABM |
3 x 1.0 ug |
EUR 339 |
STRN3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2307402 |
ABM |
1.0 ug DNA |
EUR 154 |
STRN3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2307403 |
ABM |
1.0 ug DNA |
EUR 154 |
STRN3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2307404 |
ABM |
1.0 ug DNA |
EUR 154 |
Strn3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4874302 |
ABM |
1.0 ug DNA |
EUR 154 |
Strn3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4874303 |
ABM |
1.0 ug DNA |
EUR 154 |
Strn3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4874304 |
ABM |
1.0 ug DNA |
EUR 154 |
ELISA kit for Rat Striatin-3 (STRN3) |
KTE100141-48T |
Abbkine |
48T |
EUR 332 |
- Anovel nuclear protein mainly expressed in S and G2 phase cells was characterized using autoantibodies from a cancer patient. cDNA clones were isolated by immunoscreening, and sequence analysis revealed that the cDNA clones encoded a 713-amino acid r
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Striatin-3 (STRN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Striatin-3 (STRN3) |
KTE100141-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Anovel nuclear protein mainly expressed in S and G2 phase cells was characterized using autoantibodies from a cancer patient. cDNA clones were isolated by immunoscreening, and sequence analysis revealed that the cDNA clones encoded a 713-amino acid r
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Striatin-3 (STRN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Striatin-3 (STRN3) |
KTE100141-96T |
Abbkine |
96T |
EUR 539 |
- Anovel nuclear protein mainly expressed in S and G2 phase cells was characterized using autoantibodies from a cancer patient. cDNA clones were isolated by immunoscreening, and sequence analysis revealed that the cDNA clones encoded a 713-amino acid r
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Striatin-3 (STRN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Striatin-3 (STRN3) |
KTE10079-48T |
Abbkine |
48T |
EUR 354 |
- Anovel nuclear protein mainly expressed in S and G2 phase cells was characterized using autoantibodies from a cancer patient. cDNA clones were isolated by immunoscreening, and sequence analysis revealed that the cDNA clones encoded a 713-amino acid r
- Show more
|
Description: Quantitative sandwich ELISA for measuring Bovine Striatin-3 (STRN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Striatin-3 (STRN3) |
KTE10079-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- Anovel nuclear protein mainly expressed in S and G2 phase cells was characterized using autoantibodies from a cancer patient. cDNA clones were isolated by immunoscreening, and sequence analysis revealed that the cDNA clones encoded a 713-amino acid r
- Show more
|
Description: Quantitative sandwich ELISA for measuring Bovine Striatin-3 (STRN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Bovine Striatin-3 (STRN3) |
KTE10079-96T |
Abbkine |
96T |
EUR 572 |
- Anovel nuclear protein mainly expressed in S and G2 phase cells was characterized using autoantibodies from a cancer patient. cDNA clones were isolated by immunoscreening, and sequence analysis revealed that the cDNA clones encoded a 713-amino acid r
- Show more
|
Description: Quantitative sandwich ELISA for measuring Bovine Striatin-3 (STRN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Strn3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7109502 |
ABM |
1.0 ug DNA |
EUR 154 |
Strn3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7109503 |
ABM |
1.0 ug DNA |
EUR 154 |
Strn3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7109504 |
ABM |
1.0 ug DNA |
EUR 154 |
ELISA kit for Mouse Striatin-3 (STRN3) |
KTE70273-48T |
Abbkine |
48T |
EUR 332 |
- Anovel nuclear protein mainly expressed in S and G2 phase cells was characterized using autoantibodies from a cancer patient. cDNA clones were isolated by immunoscreening, and sequence analysis revealed that the cDNA clones encoded a 713-amino acid r
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Striatin-3 (STRN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Striatin-3 (STRN3) |
KTE70273-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Anovel nuclear protein mainly expressed in S and G2 phase cells was characterized using autoantibodies from a cancer patient. cDNA clones were isolated by immunoscreening, and sequence analysis revealed that the cDNA clones encoded a 713-amino acid r
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Striatin-3 (STRN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Striatin-3 (STRN3) |
KTE70273-96T |
Abbkine |
96T |
EUR 539 |
- Anovel nuclear protein mainly expressed in S and G2 phase cells was characterized using autoantibodies from a cancer patient. cDNA clones were isolated by immunoscreening, and sequence analysis revealed that the cDNA clones encoded a 713-amino acid r
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Striatin-3 (STRN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Striatin-3 (STRN3) |
KTE60394-48T |
Abbkine |
48T |
EUR 332 |
- Anovel nuclear protein mainly expressed in S and G2 phase cells was characterized using autoantibodies from a cancer patient. cDNA clones were isolated by immunoscreening, and sequence analysis revealed that the cDNA clones encoded a 713-amino acid r
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Striatin-3 (STRN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Striatin-3 (STRN3) |
KTE60394-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Anovel nuclear protein mainly expressed in S and G2 phase cells was characterized using autoantibodies from a cancer patient. cDNA clones were isolated by immunoscreening, and sequence analysis revealed that the cDNA clones encoded a 713-amino acid r
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Striatin-3 (STRN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Striatin-3 (STRN3) |
KTE60394-96T |
Abbkine |
96T |
EUR 539 |
- Anovel nuclear protein mainly expressed in S and G2 phase cells was characterized using autoantibodies from a cancer patient. cDNA clones were isolated by immunoscreening, and sequence analysis revealed that the cDNA clones encoded a 713-amino acid r
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Striatin-3 (STRN3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
STRN3 Protein Vector (Human) (pPB-C-His) |
PV058441 |
ABM |
500 ng |
EUR 481 |
STRN3 Protein Vector (Human) (pPB-N-His) |
PV058442 |
ABM |
500 ng |
EUR 481 |
STRN3 Protein Vector (Human) (pPM-C-HA) |
PV058443 |
ABM |
500 ng |
EUR 481 |
STRN3 Protein Vector (Human) (pPM-C-His) |
PV058444 |
ABM |
500 ng |
EUR 481 |
STRN3 Protein Vector (Human) (pPB-C-His) |
PV058445 |
ABM |
500 ng |
EUR 481 |
STRN3 Protein Vector (Human) (pPB-N-His) |
PV058446 |
ABM |
500 ng |
EUR 481 |
STRN3 Protein Vector (Human) (pPM-C-HA) |
PV058447 |
ABM |
500 ng |
EUR 481 |
STRN3 Protein Vector (Human) (pPM-C-His) |
PV058448 |
ABM |
500 ng |
EUR 481 |
STRN3 Protein Vector (Rat) (pPB-C-His) |
PV308738 |
ABM |
500 ng |
EUR 1191 |
STRN3 Protein Vector (Rat) (pPB-N-His) |
PV308739 |
ABM |
500 ng |
EUR 1191 |
STRN3 Protein Vector (Rat) (pPM-C-HA) |
PV308740 |
ABM |
500 ng |
EUR 1191 |
STRN3 Protein Vector (Rat) (pPM-C-His) |
PV308741 |
ABM |
500 ng |
EUR 1191 |
STRN3 Protein Vector (Mouse) (pPB-C-His) |
PV234930 |
ABM |
500 ng |
EUR 1065 |
STRN3 Protein Vector (Mouse) (pPB-N-His) |
PV234931 |
ABM |
500 ng |
EUR 1065 |
STRN3 Protein Vector (Mouse) (pPM-C-HA) |
PV234932 |
ABM |
500 ng |
EUR 1065 |
STRN3 Protein Vector (Mouse) (pPM-C-His) |
PV234933 |
ABM |
500 ng |
EUR 1065 |
STRN3 Protein Vector (Mouse) (pPB-C-His) |
PV234934 |
ABM |
500 ng |
EUR 1065 |
STRN3 Protein Vector (Mouse) (pPB-N-His) |
PV234935 |
ABM |
500 ng |
EUR 1065 |
STRN3 Protein Vector (Mouse) (pPM-C-HA) |
PV234936 |
ABM |
500 ng |
EUR 1065 |
STRN3 Protein Vector (Mouse) (pPM-C-His) |
PV234937 |
ABM |
500 ng |
EUR 1065 |
Strn3 3'UTR GFP Stable Cell Line |
TU169882 |
ABM |
1.0 ml |
Ask for price |
Strn3 3'UTR Luciferase Stable Cell Line |
TU119882 |
ABM |
1.0 ml |
Ask for price |
STRN3 3'UTR GFP Stable Cell Line |
TU074857 |
ABM |
1.0 ml |
EUR 1521 |
STRN3 3'UTR Luciferase Stable Cell Line |
TU024857 |
ABM |
1.0 ml |
EUR 1521 |
Strn3 3'UTR Luciferase Stable Cell Line |
TU221347 |
ABM |
1.0 ml |
Ask for price |
Strn3 3'UTR GFP Stable Cell Line |
TU271347 |
ABM |
1.0 ml |
Ask for price |
STRN3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV665449 |
ABM |
1.0 ug DNA |
EUR 1355 |
STRN3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV665453 |
ABM |
1.0 ug DNA |
EUR 1355 |
STRN3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV665454 |
ABM |
1.0 ug DNA |
EUR 1355 |
STRN3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV702321 |
ABM |
1.0 ug DNA |
EUR 450 |
STRN3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV702325 |
ABM |
1.0 ug DNA |
EUR 450 |
STRN3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV702326 |
ABM |
1.0 ug DNA |
EUR 450 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
STRN3 Rabbit Polyclonal Antibody