TRIB3 Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
TRIB3 Polyclonal Antibody |
ABP60758-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human TRIB3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of TRIB3 from Human. This TRIB3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRIB3 protein |
TRIB3 Rabbit pAb |
A5424-100ul |
Abclonal |
100 ul |
EUR 308 |
TRIB3 Rabbit pAb |
A5424-200ul |
Abclonal |
200 ul |
EUR 459 |
TRIB3 Rabbit pAb |
A5424-20ul |
Abclonal |
20 ul |
EUR 183 |
TRIB3 Rabbit pAb |
A5424-50ul |
Abclonal |
50 ul |
EUR 223 |
TRIB3 Rabbit pAb |
A2346-100ul |
Abclonal |
100 ul |
EUR 308 |
TRIB3 Rabbit pAb |
A2346-200ul |
Abclonal |
200 ul |
EUR 459 |
TRIB3 Rabbit pAb |
A2346-20ul |
Abclonal |
20 ul |
Ask for price |
TRIB3 Rabbit pAb |
A2346-50ul |
Abclonal |
50 ul |
Ask for price |
TRIB3 antibody |
70R-51057 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal TRIB3 antibody |
TRIB3 antibody |
70R-3572 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal TRIB3 antibody |
TRIB3 antibody |
70R-20973 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal TRIB3 antibody |
TRIB3 Antibody |
40167-100ul |
SAB |
100ul |
EUR 252 |
TRIB3 Antibody |
DF7844 |
Affbiotech |
200ul |
EUR 304 |
Description: TRIB3 Antibody detects endogenous levels of total TRIB3. |
TRIB3 Antibody |
1-CSB-PA847220LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TRIB3. Recognizes TRIB3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
TRIB3 Antibody |
1-CSB-PA592034 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against TRIB3. Recognizes TRIB3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150 |
TRIB3 Antibody |
1-CSB-PA120599 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against TRIB3. Recognizes TRIB3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
TRIB3 Antibody |
1-CSB-PA024446GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against TRIB3. Recognizes TRIB3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Polyclonal TRB3 / TRIB3 Antibody (Internal) |
APR03193G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRB3 / TRIB3 (Internal). This antibody is tested and proven to work in the following applications: |
Polyclonal TRIB3 Antibody (C-term) |
APR06077G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRIB3 (C-term). This antibody is tested and proven to work in the following applications: |
Polyclonal TRB3 / TRIB3 Antibody (N-Terminus) |
APR02010G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRB3 / TRIB3 (N-Terminus). This antibody is tested and proven to work in the following applications: |
Polyclonal TRB3 / TRIB3 Antibody (C-Terminus) |
APR02015G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRB3 / TRIB3 (C-Terminus). This antibody is tested and proven to work in the following applications: |
TRIB3 Conjugated Antibody |
C40167 |
SAB |
100ul |
EUR 397 |
anti- TRIB3 antibody |
FNab08966 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:5000
- IP: 1:200-1:2000
- Immunogen: tribbles homolog 3(Drosophila)
- Uniprot ID: Q96RU7
- Gene ID: 57761
- Research Area: Signal Transduction, Metabolism
|
Description: Antibody raised against TRIB3 |
Anti-TRIB3 antibody |
STJ25963 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a putative protein kinase that is induced by the transcription factor NF-kappaB. The encoded protein is a negative regulator of NF-kappaB and can also sensitize cells to TNF- and TRAIL-induced apoptosis. In addition, this protein can negatively regulate the cell survival serine-threonine kinase AKT1. Differential promoter usage and alternate splicing result in multiple transcript variants. |
Anti-TRIB3 antibody |
STJ27377 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a putative protein kinase that is induced by the transcription factor NF-kappaB. The encoded protein is a negative regulator of NF-kappaB and can also sensitize cells to TNF- and TRAIL-induced apoptosis. In addition, this protein can negatively regulate the cell survival serine-threonine kinase AKT1. Differential promoter usage and alternate splicing result in multiple transcript variants. |
Anti-TRIB3 antibody |
STJ191991 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to TRIB3 |
TRIB3 siRNA |
20-abx905776 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TRIB3 siRNA |
20-abx938004 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TRIB3 siRNA |
20-abx938005 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-TRIB3 |
YF-PA20284 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to TRIB3 |
anti-TRIB3 |
YF-PA20285 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to TRIB3 |
TRIB3 Antibody, HRP conjugated |
1-CSB-PA847220LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TRIB3. Recognizes TRIB3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
TRIB3 Antibody, FITC conjugated |
1-CSB-PA847220LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TRIB3. Recognizes TRIB3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
TRIB3 Antibody, Biotin conjugated |
1-CSB-PA847220LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TRIB3. Recognizes TRIB3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Anti-TRIB3 Monoclonal Antibody |
M01414 |
BosterBio |
100ug |
EUR 397 |
Description: Rabbit Monoclonal TRIB3 Antibody. Validated in IP, WB and tested in Human. |
TRIB3 Blocking Peptide |
20-abx063932 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TRIB3 Blocking Peptide |
33R-10278 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRIB3 antibody, catalog no. 70R-3572 |
TRIB3 Blocking Peptide |
DF7844-BP |
Affbiotech |
1mg |
EUR 195 |
TRIB3 cloning plasmid |
CSB-CL847220HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1077
- Sequence: atgcgagccacccctctggctgctcctgcgggttccctgtccaggaagaagcggttggagttggatgacaacttagataccgagcgtcccgtccagaaacgagctcgaagtgggccccagcccagactgcccccctgcctgttgcccctgagcccacctactgctccagatcgtg
- Show more
|
Description: A cloning plasmid for the TRIB3 gene. |
Anti-TRIB3 (1H2) |
YF-MA19104 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to TRIB3 |
Anti-TRIB3 (2G5) |
YF-MA19105 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to TRIB3 |
Anti-TRIB3 (3D7) |
YF-MA19106 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to TRIB3 |
Anti-TRIB3 (2D1) |
YF-MA19107 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to TRIB3 |
Anti-TRIB3 (2F7) |
YF-MA11617 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to TRIB3 |
Monoclonal TRIB3 Antibody, Clone: EPR3150 |
APR13800G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human TRIB3. The antibodies are raised in Rabbit and are from clone EPR3150. This antibody is applicable in WB |
Tribbles Homolog 3 (TRIB3) Antibody |
20-abx001903 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Tribbles Homolog 3 (TRIB3) Antibody |
abx145410-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Tribbles Homolog 3 (TRIB3) Antibody |
abx033920-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Tribbles Homolog 3 (TRIB3) Antibody |
abx033920-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Tribbles Homolog 3 (TRIB3) Antibody |
20-abx006614 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Tribbles Homolog 3 (TRIB3) Antibody |
20-abx008081 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Tribbles Homolog 3 (TRIB3) Antibody |
abx238966-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Tribbles Homolog 3 (TRIB3) Antibody |
20-abx301787 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Tribbles Homolog 3 (TRIB3) Antibody |
20-abx210281 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Tribbles Homolog 3 (TRIB3) Antibody |
20-abx210462 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Tribbles Homolog 3 (TRIB3) Antibody (HRP) |
20-abx314602 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Tribbles Homolog 3 (TRIB3) Antibody (FITC) |
20-abx314603 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Tribbles Homolog 3 (TRIB3) Antibody (Biotin) |
20-abx314604 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Rat TRIB3 shRNA Plasmid |
20-abx987973 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
TRIB3 protein (His tag) |
80R-4057 |
Fitzgerald |
50 ug |
EUR 327 |
Description: Recombinant Human TRIB3 protein (His tag) |
Mouse TRIB3 shRNA Plasmid |
20-abx981648 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human TRIB3 shRNA Plasmid |
20-abx961670 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
TRIB3 Recombinant Protein (Human) |
RP032860 |
ABM |
100 ug |
Ask for price |
TRIB3 Recombinant Protein (Rat) |
RP234629 |
ABM |
100 ug |
Ask for price |
TRIB3 Recombinant Protein (Mouse) |
RP181031 |
ABM |
100 ug |
Ask for price |
Monoclonal TRIB3 Antibody (monoclonal) (M03), Clone: 1H2 |
AMM04244G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human TRIB3 (monoclonal) (M03). The antibodies are raised in mouse and are from clone 1H2. This antibody is applicable in WB and IF |
Monoclonal TRIB3 Antibody (monoclonal) (M06), Clone: 2G5 |
AMM04245G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human TRIB3 (monoclonal) (M06). The antibodies are raised in mouse and are from clone 2G5. This antibody is applicable in WB and IF, E |
h TRIB3 inducible lentiviral particles |
LVP128 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, TRIB3, is fully sequence verified and matched to NCBI accession ID: NM_021158 |
Trib3 ORF Vector (Rat) (pORF) |
ORF078211 |
ABM |
1.0 ug DNA |
EUR 506 |
TRIB3 ORF Vector (Human) (pORF) |
ORF010954 |
ABM |
1.0 ug DNA |
EUR 95 |
Trib3 ORF Vector (Mouse) (pORF) |
ORF060345 |
ABM |
1.0 ug DNA |
EUR 506 |
TRIB3 ELISA Kit (Rat) (OKCA02608) |
OKCA02608 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
Description: Description of target: Disrupts insulin signaling by binding directly to Akt kinases and blocking their activation. May bind directly to and mask the 'Thr-308' phosphorylation site in AKT1. Binds to ATF4 and inhibits its transcriptional activation activity. Interacts with the NF-kappa-B transactivator p65 RELA and inhibits its phosphorylation and thus its transcriptional activation activity. Interacts with MAPK kinases and regulates activation of MAP kinases. May play a role in programmed neuronal cell death but does not appear to affect non-neuronal cells. Does not display kinase activity. Inhibits the transcriptional activity of DDIT3/CHOP and is involved in DDIT3/CHOP-dependent cell death during ER stress. Can inhibit APOBEC3A editing of nuclear DNA.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 10.1 pg/mL |
TRIB3 sgRNA CRISPR Lentivector set (Human) |
K2462801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Trib3 sgRNA CRISPR Lentivector set (Mouse) |
K4286101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Trib3 sgRNA CRISPR Lentivector set (Rat) |
K7247001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cow Tribbles Homolog 3 (TRIB3) ELISA Kit |
abx521350-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Tribbles Homolog 3 (TRIB3) ELISA Kit |
abx521352-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Tribbles Homolog 3 (TRIB3) ELISA Kit |
abx521353-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human TRIB3/ Tribbles homolog 3 ELISA Kit |
E2588Hu |
Sunlong |
1 Kit |
EUR 605 |
Human TRIB3(Tribbles homolog 3) ELISA Kit |
EH2519 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: Q96RU7
- Alias: TRIB3/Tribbles homolog 3(TRB-3)/p65-interacting inhibitor of NF-kappa-B/Neuronal cell death-inducible putative kinase/SINK
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Tribbles homolog 3 (TRIB3) ELISA Kit |
abx251890-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
TRIB3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2462802 |
ABM |
1.0 ug DNA |
EUR 154 |
TRIB3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2462803 |
ABM |
1.0 ug DNA |
EUR 154 |
TRIB3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2462804 |
ABM |
1.0 ug DNA |
EUR 154 |
Trib3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4286102 |
ABM |
1.0 ug DNA |
EUR 154 |
Trib3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4286103 |
ABM |
1.0 ug DNA |
EUR 154 |
Trib3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4286104 |
ABM |
1.0 ug DNA |
EUR 154 |
Human Tribbles homolog 3(TRIB3) ELISA kit |
CSB-EL024446HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Tribbles homolog 3 (TRIB3) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Tribbles homolog 3(TRIB3) ELISA kit |
1-CSB-EL024446HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Tribbles homolog 3(TRIB3) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Trib3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7247002 |
ABM |
1.0 ug DNA |
EUR 154 |
Trib3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7247003 |
ABM |
1.0 ug DNA |
EUR 154 |
Trib3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7247004 |
ABM |
1.0 ug DNA |
EUR 154 |
TRIB3 Protein Vector (Human) (pPB-C-His) |
PV043813 |
ABM |
500 ng |
EUR 329 |
TRIB3 Protein Vector (Human) (pPB-N-His) |
PV043814 |
ABM |
500 ng |
EUR 329 |
TRIB3 Protein Vector (Human) (pPM-C-HA) |
PV043815 |
ABM |
500 ng |
EUR 329 |
TRIB3 Protein Vector (Human) (pPM-C-His) |
PV043816 |
ABM |
500 ng |
EUR 329 |
Recombinant Human TRIB3 Protein, His, E.coli-10ug |
QP13815-10ug |
EnQuireBio |
10ug |
EUR 201 |
Recombinant Human TRIB3 Protein, His, E.coli-1mg |
QP13815-1mg |
EnQuireBio |
1mg |
EUR 5251 |
Recombinant Human TRIB3 Protein, His, E.coli-2ug |
QP13815-2ug |
EnQuireBio |
2ug |
EUR 155 |
TRIB3 Tribbles Pseudokinase 3 Human Recombinant Protein |
PROTQ96RU7 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: TRIB3 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 381 amino acids (1-358 a.a) and having a molecular mass of 42.0kDa. TRIB3 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
TRIB3 Protein Vector (Rat) (pPB-C-His) |
PV312842 |
ABM |
500 ng |
EUR 603 |
TRIB3 Protein Vector (Rat) (pPB-N-His) |
PV312843 |
ABM |
500 ng |
EUR 603 |
TRIB3 Protein Vector (Rat) (pPM-C-HA) |
PV312844 |
ABM |
500 ng |
EUR 603 |
TRIB3 Protein Vector (Rat) (pPM-C-His) |
PV312845 |
ABM |
500 ng |
EUR 603 |
TRIB3 Protein Vector (Mouse) (pPB-C-His) |
PV241378 |
ABM |
500 ng |
EUR 603 |
TRIB3 Protein Vector (Mouse) (pPB-N-His) |
PV241379 |
ABM |
500 ng |
EUR 603 |
TRIB3 Protein Vector (Mouse) (pPM-C-HA) |
PV241380 |
ABM |
500 ng |
EUR 603 |
TRIB3 Protein Vector (Mouse) (pPM-C-His) |
PV241381 |
ABM |
500 ng |
EUR 603 |
Trib3 3'UTR GFP Stable Cell Line |
TU171070 |
ABM |
1.0 ml |
Ask for price |
TRIB3 3'UTR GFP Stable Cell Line |
TU076511 |
ABM |
1.0 ml |
EUR 1394 |
Trib3 3'UTR Luciferase Stable Cell Line |
TU121070 |
ABM |
1.0 ml |
Ask for price |
TRIB3 3'UTR Luciferase Stable Cell Line |
TU026511 |
ABM |
1.0 ml |
EUR 1394 |
Trib3 3'UTR Luciferase Stable Cell Line |
TU222419 |
ABM |
1.0 ml |
Ask for price |
Trib3 3'UTR GFP Stable Cell Line |
TU272419 |
ABM |
1.0 ml |
Ask for price |
TRIB3 ELISA Kit (Human) : 96 Wells (OKEH02021) |
OKEH02021 |
Aviva Systems Biology |
96 Wells |
EUR 727 |
Description: Description of target: The protein encoded by this gene is a putative protein kinase that is induced by the transcription factor NF-kappaB. The encoded protein is a negative regulator of NF-kappaB and can also sensitize cells to TNF- and TRAIL-induced apoptosis. In addition, this protein can negatively regulate the cell survival serine-threonine kinase AKT1. Differential promoter usage and alternate splicing result in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
TRIB3 Rabbit Polyclonal Antibody