TRIB3 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

TRIB3 Polyclonal Antibody

ES10833-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TRIB3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

TRIB3 Rabbit pAb

A5424-100ul 100 ul
EUR 308

TRIB3 Rabbit pAb

A5424-200ul 200 ul
EUR 459

TRIB3 Rabbit pAb

A5424-20ul 20 ul
EUR 183

TRIB3 Rabbit pAb

A5424-50ul 50 ul
EUR 223

TRIB3 Rabbit pAb

A2346-100ul 100 ul
EUR 308

TRIB3 Rabbit pAb

A2346-200ul 200 ul
EUR 459

TRIB3 Rabbit pAb

A2346-20ul 20 ul Ask for price

TRIB3 Rabbit pAb

A2346-50ul 50 ul Ask for price

TRIB3 antibody

70R-20973 50 ul
EUR 435
Description: Rabbit polyclonal TRIB3 antibody

TRIB3 Antibody

40167-100ul 100ul
EUR 252

TRIB3 Antibody

1-CSB-PA847220LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRIB3. Recognizes TRIB3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

TRIB3 Antibody

1-CSB-PA120599
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRIB3. Recognizes TRIB3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

TRIB3 Antibody

DF7844 200ul
EUR 304
Description: TRIB3 Antibody detects endogenous levels of total TRIB3.

TRIB3 Antibody

1-CSB-PA592034
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRIB3. Recognizes TRIB3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

TRIB3 antibody

70R-3572 50 ug
EUR 467
Description: Rabbit polyclonal TRIB3 antibody

TRIB3 antibody

70R-51057 100 ul
EUR 244
Description: Purified Polyclonal TRIB3 antibody

TRIB3 Antibody

1-CSB-PA024446GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TRIB3. Recognizes TRIB3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

TRIB3 Antibody

ABD7844 100 ug
EUR 438

Polyclonal TRB3 / TRIB3 Antibody (Internal)

APR03193G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRB3 / TRIB3 (Internal). This antibody is tested and proven to work in the following applications:

Polyclonal TRIB3 Antibody (C-term)

APR06077G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRIB3 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal TRB3 / TRIB3 Antibody (N-Terminus)

APR02010G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRB3 / TRIB3 (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal TRB3 / TRIB3 Antibody (C-Terminus)

APR02015G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRB3 / TRIB3 (C-Terminus). This antibody is tested and proven to work in the following applications:

TRIB3 Conjugated Antibody

C40167 100ul
EUR 397

anti- TRIB3 antibody

FNab08966 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IP: 1:200-1:2000
  • Immunogen: tribbles homolog 3(Drosophila)
  • Uniprot ID: Q96RU7
  • Gene ID: 57761
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against TRIB3

Anti-TRIB3 antibody

PAab08966 100 ug
EUR 386

Anti-TRIB3 antibody

STJ25963 100 µl
EUR 277
Description: The protein encoded by this gene is a putative protein kinase that is induced by the transcription factor NF-kappaB. The encoded protein is a negative regulator of NF-kappaB and can also sensitize cells to TNF- and TRAIL-induced apoptosis. In addition, this protein can negatively regulate the cell survival serine-threonine kinase AKT1. Differential promoter usage and alternate splicing result in multiple transcript variants.

Anti-TRIB3 antibody

STJ27377 100 µl
EUR 277
Description: The protein encoded by this gene is a putative protein kinase that is induced by the transcription factor NF-kappaB. The encoded protein is a negative regulator of NF-kappaB and can also sensitize cells to TNF- and TRAIL-induced apoptosis. In addition, this protein can negatively regulate the cell survival serine-threonine kinase AKT1. Differential promoter usage and alternate splicing result in multiple transcript variants.

Anti-TRIB3 antibody

STJ191991 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TRIB3

Trib3/ Rat Trib3 ELISA Kit

ELI-51153r 96 Tests
EUR 886

TRIB3 siRNA

20-abx905776
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TRIB3 siRNA

20-abx938004
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TRIB3 siRNA

20-abx938005
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-TRIB3

YF-PA20284 50 ug
EUR 363
Description: Mouse polyclonal to TRIB3

anti-TRIB3

YF-PA20285 100 ug
EUR 403
Description: Rabbit polyclonal to TRIB3

TRIB3 Antibody, HRP conjugated

1-CSB-PA847220LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRIB3. Recognizes TRIB3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TRIB3 Antibody, FITC conjugated

1-CSB-PA847220LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRIB3. Recognizes TRIB3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TRIB3 Antibody, Biotin conjugated

1-CSB-PA847220LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRIB3. Recognizes TRIB3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-TRIB3 Monoclonal Antibody

M01414 100ug
EUR 397
Description: Rabbit Monoclonal TRIB3 Antibody. Validated in IP, WB and tested in Human.

TRIB3 Blocking Peptide

33R-10278 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRIB3 antibody, catalog no. 70R-3572

TRIB3 Blocking Peptide

DF7844-BP 1mg
EUR 195

TRIB3 Blocking Peptide

20-abx063932
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

TRIB3 cloning plasmid

CSB-CL847220HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1077
  • Sequence: atgcgagccacccctctggctgctcctgcgggttccctgtccaggaagaagcggttggagttggatgacaacttagataccgagcgtcccgtccagaaacgagctcgaagtgggccccagcccagactgcccccctgcctgttgcccctgagcccacctactgctccagatcgtg
  • Show more
Description: A cloning plasmid for the TRIB3 gene.

Anti-TRIB3 (2F7)

YF-MA11617 100 ug
EUR 363
Description: Mouse monoclonal to TRIB3

Anti-TRIB3 (1H2)

YF-MA19104 100 ug
EUR 363
Description: Mouse monoclonal to TRIB3

Anti-TRIB3 (2G5)

YF-MA19105 100 ug
EUR 363
Description: Mouse monoclonal to TRIB3

Anti-TRIB3 (3D7)

YF-MA19106 100 ug
EUR 363
Description: Mouse monoclonal to TRIB3

Anti-TRIB3 (2D1)

YF-MA19107 100 ug
EUR 363
Description: Mouse monoclonal to TRIB3

Tribbles Homolog 3 (TRIB3) Antibody

20-abx008081
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Tribbles Homolog 3 (TRIB3) Antibody

20-abx006614
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tribbles Homolog 3 (TRIB3) Antibody

20-abx210281
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tribbles Homolog 3 (TRIB3) Antibody

20-abx210462
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tribbles Homolog 3 (TRIB3) Antibody

abx145410-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Tribbles Homolog 3 (TRIB3) Antibody

abx033920-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Tribbles Homolog 3 (TRIB3) Antibody

abx033920-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Tribbles Homolog 3 (TRIB3) Antibody

abx238966-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Monoclonal TRIB3 Antibody, Clone: EPR3150

APR13800G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human TRIB3. The antibodies are raised in Rabbit and are from clone EPR3150. This antibody is applicable in WB

Tribbles Homolog 3 (TRIB3) Antibody

20-abx301787
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tribbles Homolog 3 (TRIB3) Antibody

20-abx001903
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Tribbles Homolog 3 (TRIB3) Antibody (HRP)

20-abx314602
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tribbles Homolog 3 (TRIB3) Antibody (FITC)

20-abx314603
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tribbles Homolog 3 (TRIB3) Antibody (Biotin)

20-abx314604
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

TRIB3 protein (His tag)

80R-4057 50 ug
EUR 327
Description: Recombinant Human TRIB3 protein (His tag)

Human TRIB3 ELISA Kit

ELA-E9844h 96 Tests
EUR 824

TRIB3 ELISA KIT|Human

EF006551 96 Tests
EUR 689

Rat TRIB3 shRNA Plasmid

20-abx987973
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse TRIB3 shRNA Plasmid

20-abx981648
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TRIB3 shRNA Plasmid

20-abx961670
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TRIB3 Recombinant Protein (Rat)

RP234629 100 ug Ask for price

pCMV-SPORT6-TRIB3 Plasmid

PVT16467 2 ug
EUR 325

TRIB3 Recombinant Protein (Human)

RP032860 100 ug Ask for price

TRIB3 Recombinant Protein (Mouse)

RP181031 100 ug Ask for price

Monoclonal TRIB3 Antibody (monoclonal) (M03), Clone: 1H2

AMM04244G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human TRIB3 (monoclonal) (M03). The antibodies are raised in mouse and are from clone 1H2. This antibody is applicable in WB and IF

Monoclonal TRIB3 Antibody (monoclonal) (M06), Clone: 2G5

AMM04245G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human TRIB3 (monoclonal) (M06). The antibodies are raised in mouse and are from clone 2G5. This antibody is applicable in WB and IF, E

Trib3 ORF Vector (Rat) (pORF)

ORF078211 1.0 ug DNA
EUR 506

h TRIB3 inducible lentiviral particles

LVP128 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, TRIB3, is fully sequence verified and matched to NCBI accession ID: NM_021158

TRIB3 ORF Vector (Human) (pORF)

ORF010954 1.0 ug DNA
EUR 95

Trib3 ORF Vector (Mouse) (pORF)

ORF060345 1.0 ug DNA
EUR 506

TRIB3 ELISA Kit (Rat) (OKCA02608)

OKCA02608 96 Wells
EUR 846
Description: Description of target: Disrupts insulin signaling by binding directly to Akt kinases and blocking their activation. May bind directly to and mask the 'Thr-308' phosphorylation site in AKT1. Binds to ATF4 and inhibits its transcriptional activation activity. Interacts with the NF-kappa-B transactivator p65 RELA and inhibits its phosphorylation and thus its transcriptional activation activity. Interacts with MAPK kinases and regulates activation of MAP kinases. May play a role in programmed neuronal cell death but does not appear to affect non-neuronal cells. Does not display kinase activity. Inhibits the transcriptional activity of DDIT3/CHOP and is involved in DDIT3/CHOP-dependent cell death during ER stress. Can inhibit APOBEC3A editing of nuclear DNA.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 10.1 pg/mL

Trib3 sgRNA CRISPR Lentivector set (Rat)

K7247001 3 x 1.0 ug
EUR 339

Trib3 sgRNA CRISPR Lentivector set (Mouse)

K4286101 3 x 1.0 ug
EUR 339

TRIB3 sgRNA CRISPR Lentivector set (Human)

K2462801 3 x 1.0 ug
EUR 339

Human Tribbles homolog 3(TRIB3) ELISA kit

CSB-EL024446HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tribbles homolog 3 (TRIB3) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Tribbles homolog 3(TRIB3) ELISA kit

1-CSB-EL024446HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tribbles homolog 3(TRIB3) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Tribbles homolog 3 (TRIB3) ELISA Kit

abx251890-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human TRIB3(Tribbles homolog 3) ELISA Kit

EH2519 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q96RU7
  • Alias: TRIB3/Tribbles homolog 3(TRB-3)/p65-interacting inhibitor of NF-kappa-B/Neuronal cell death-inducible putative kinase/SINK
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human TRIB3/ Tribbles homolog 3 ELISA Kit

E2588Hu 1 Kit
EUR 605

Mouse Tribbles homolog 3, Trib3 ELISA KIT

ELI-23158m 96 Tests
EUR 865

Bovine Tribbles homolog 3, TRIB3 ELISA KIT

ELI-45762b 96 Tests
EUR 928

Cow Tribbles Homolog 3 (TRIB3) ELISA Kit

abx521350-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Tribbles Homolog 3 (TRIB3) ELISA Kit

abx521352-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Tribbles Homolog 3 (TRIB3) ELISA Kit

abx521353-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Tribbles homolog 3, TRIB3 ELISA KIT

ELI-36572h 96 Tests
EUR 824

Trib3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7247002 1.0 ug DNA
EUR 154

Trib3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7247003 1.0 ug DNA
EUR 154

Trib3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7247004 1.0 ug DNA
EUR 154

Trib3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4286102 1.0 ug DNA
EUR 154

Trib3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4286103 1.0 ug DNA
EUR 154

Trib3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4286104 1.0 ug DNA
EUR 154

TRIB3 sgRNA CRISPR Lentivector (Human) (Target 1)

K2462802 1.0 ug DNA
EUR 154

TRIB3 sgRNA CRISPR Lentivector (Human) (Target 2)

K2462803 1.0 ug DNA
EUR 154

TRIB3 sgRNA CRISPR Lentivector (Human) (Target 3)

K2462804 1.0 ug DNA
EUR 154

TRIB3 Tribbles Pseudokinase 3 Human Recombinant Protein

PROTQ96RU7 Regular: 10ug
EUR 317
Description: TRIB3 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 381 amino acids (1-358 a.a) and having a molecular mass of 42.0kDa. TRIB3 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

TRIB3 Protein Vector (Rat) (pPB-C-His)

PV312842 500 ng
EUR 603

TRIB3 Protein Vector (Rat) (pPB-N-His)

PV312843 500 ng
EUR 603

TRIB3 Protein Vector (Rat) (pPM-C-HA)

PV312844 500 ng
EUR 603

TRIB3 Protein Vector (Rat) (pPM-C-His)

PV312845 500 ng
EUR 603

TRIB3 Protein Vector (Mouse) (pPB-C-His)

PV241378 500 ng
EUR 603

TRIB3 Protein Vector (Mouse) (pPB-N-His)

PV241379 500 ng
EUR 603

TRIB3 Protein Vector (Mouse) (pPM-C-HA)

PV241380 500 ng
EUR 603

TRIB3 Protein Vector (Mouse) (pPM-C-His)

PV241381 500 ng
EUR 603

TRIB3 Protein Vector (Human) (pPB-C-His)

PV043813 500 ng
EUR 329

TRIB3 Protein Vector (Human) (pPB-N-His)

PV043814 500 ng
EUR 329

TRIB3 Protein Vector (Human) (pPM-C-HA)

PV043815 500 ng
EUR 329

TRIB3 Protein Vector (Human) (pPM-C-His)

PV043816 500 ng
EUR 329

Recombinant Human TRIB3 Protein, His, E.coli-10ug

QP13815-10ug 10ug
EUR 201

Recombinant Human TRIB3 Protein, His, E.coli-1mg

QP13815-1mg 1mg
EUR 5251

Recombinant Human TRIB3 Protein, His, E.coli-2ug

QP13815-2ug 2ug
EUR 155

Trib3 3'UTR Luciferase Stable Cell Line

TU121070 1.0 ml Ask for price

Trib3 3'UTR GFP Stable Cell Line

TU171070 1.0 ml Ask for price

Trib3 3'UTR Luciferase Stable Cell Line

TU222419 1.0 ml Ask for price

TRIB3 3'UTR GFP Stable Cell Line

TU076511 1.0 ml
EUR 1394

TRIB3 3'UTR Luciferase Stable Cell Line

TU026511 1.0 ml
EUR 1394

Trib3 3'UTR GFP Stable Cell Line

TU272419 1.0 ml Ask for price

TRIB3 ELISA Kit (Human) : 96 Wells (OKEH02021)

OKEH02021 96 Wells
EUR 727
Description: Description of target: The protein encoded by this gene is a putative protein kinase that is induced by the transcription factor NF-kappaB. The encoded protein is a negative regulator of NF-kappaB and can also sensitize cells to TNF- and TRAIL-induced apoptosis. In addition, this protein can negatively regulate the cell survival serine-threonine kinase AKT1. Differential promoter usage and alternate splicing result in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody

ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody

ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody

ABP57570-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK3 Rabbit Polyclonal Antibody

ABP57572-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody

ABP57572-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody

ABP57572-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

MEK2 Rabbit Polyclonal Antibody

ABP57573-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody

ABP57573-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody

ABP57573-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK3 Rabbit Polyclonal Antibody

ABP57574-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody

ABP57574-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody

ABP57574-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

Nrf2 Rabbit Polyclonal Antibody

ABP57575-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody

ABP57575-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody

ABP57575-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

ATG4a Rabbit Polyclonal Antibody

ABP57576-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG4a
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody

ABP57576-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG4a
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody

ABP57576-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG4a
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4b Rabbit Polyclonal Antibody

ABP57577-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG4b
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

TRIB3 Rabbit Polyclonal Antibody