UBA6 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

UBA6 Polyclonal Antibody

ABP60817-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human UBA6 protein
  • Applications tips:
Description: A polyclonal antibody for detection of UBA6 from Human, Mouse. This UBA6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBA6 protein

UBA6 Polyclonal Antibody

ABP60817-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human UBA6 protein
  • Applications tips:
Description: A polyclonal antibody for detection of UBA6 from Human, Mouse. This UBA6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBA6 protein

UBA6 Polyclonal Antibody

ABP60817-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human UBA6 protein
  • Applications tips:
Description: A polyclonal antibody for detection of UBA6 from Human, Mouse. This UBA6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBA6 protein

UBA6 Rabbit pAb

A4819-100ul 100 ul
EUR 308

UBA6 Rabbit pAb

A4819-200ul 200 ul
EUR 459

UBA6 Rabbit pAb

A4819-20ul 20 ul Ask for price

UBA6 Rabbit pAb

A4819-50ul 50 ul Ask for price

UBA6 Rabbit pAb

A7511-100ul 100 ul
EUR 308

UBA6 Rabbit pAb

A7511-200ul 200 ul
EUR 459

UBA6 Rabbit pAb

A7511-20ul 20 ul
EUR 183

UBA6 Rabbit pAb

A7511-50ul 50 ul
EUR 223

UBA6 antibody

70R-21088 50 ul
EUR 435
Description: Rabbit polyclonal UBA6 antibody

UBA6 antibody

70R-9758 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal UBA6 antibody

UBA6 Antibody

43598-100ul 100ul
EUR 252

UBA6 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against UBA6. Recognizes UBA6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

UBA6 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against UBA6. Recognizes UBA6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

UBA6 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against UBA6. Recognizes UBA6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

UBA6 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBA6. Recognizes UBA6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

Polyclonal UBA6 Antibody (C-term)

APR04152G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UBA6 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal UBA6 Antibody (C-term)

APR06963G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UBA6 (C-term). This antibody is tested and proven to work in the following applications:

UBA6 Conjugated Antibody

C43598 100ul
EUR 397

anti- UBA6 antibody

FNab09146 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: ubiquitin-like modifier activating enzyme 6
  • Uniprot ID: A0AVT1
  • Gene ID: 55236
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against UBA6

Anti-UBA6 antibody

PAab09146 100 ug
EUR 386

Anti-UBA6 antibody

STJ29647 100 µl
EUR 277

Anti-UBA6 antibody

STJ26888 100 µl
EUR 277

Anti-UBA6 antibody

STJ191587 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to UBA6


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

UBA6 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBA6. Recognizes UBA6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

UBA6 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBA6. Recognizes UBA6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

UBA6 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBA6. Recognizes UBA6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

UBA6 cloning plasmid

CSB-CL025420HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1170
  • Sequence: atggaaggatccgagcctgtggccgcccatcagggggaagaggcgtcctgttcttcctgggggactggcagcacaaataaaaatttgcccattatgtcaacagcatctgtggaaatcgatgatgcattgtatagtcgacagaggtacgttcttggagacacagcaatgcagaaga
  • Show more
Description: A cloning plasmid for the UBA6 gene.

UBA6 cloning plasmid

CSB-CL025420HU2-10ug 10ug
EUR 1130
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3159
  • Sequence: atggaaggatccgagcctgtggccgcccatcagggggaagaggcgtcctgttcttcctgggggactggcagcacaaataaaaatttgcccattatgtcaacagcatctgtggaaatcgatgatgcattgtatagtcgacagaggtacgttcttggagacacagcaatgcagaaga
  • Show more
Description: A cloning plasmid for the UBA6 gene.

UBA6 Rabbit Polyclonal Antibody