UBE2K Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

UBE2K Polyclonal Antibody
ES10447-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against UBE2K from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
UBE2K Polyclonal Antibody
ABP60821-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human UBE2K protein
  • Applications tips:
Description: A polyclonal antibody for detection of UBE2K from Human, Mouse. This UBE2K antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBE2K protein
UBE2K Polyclonal Antibody
ABP60821-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human UBE2K protein
  • Applications tips:
Description: A polyclonal antibody for detection of UBE2K from Human, Mouse. This UBE2K antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBE2K protein
UBE2K Polyclonal Antibody
ABP60821-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human UBE2K protein
  • Applications tips:
Description: A polyclonal antibody for detection of UBE2K from Human, Mouse. This UBE2K antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBE2K protein
UBE2K Polyclonal Antibody
A-8703 100 µl
EUR 724.25
Description: Ask the seller for details
UBE2K Polyclonal Antibody
A57858 100 µg
EUR 570.55
Description: fast delivery possible
UBE2K Polyclonal Antibody
A53456 100 µg
EUR 570.55
Description: The best epigenetics products
UBE2K Rabbit pAb
A0655-100ul 100 ul
EUR 308
UBE2K Rabbit pAb
A0655-200ul 200 ul
EUR 459
UBE2K Rabbit pAb
A0655-20ul 20 ul Ask for price
UBE2K Rabbit pAb
A0655-50ul 50 ul Ask for price
UBE2K Rabbit pAb
A1086-100ul 100 ul
EUR 308
UBE2K Rabbit pAb
A1086-200ul 200 ul
EUR 459
UBE2K Rabbit pAb
A1086-20ul 20 ul
EUR 183
UBE2K Rabbit pAb
A1086-50ul 50 ul
EUR 223
UBE2K antibody
70R-21107 50 ul
EUR 435
Description: Rabbit polyclonal UBE2K antibody
UBE2K antibody
70R-2724 50 ug
EUR 467
Description: Rabbit polyclonal UBE2K antibody
UBE2K antibody
70R-9579 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal UBE2K antibody
UBE2K antibody
70R-9580 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal UBE2K antibody
UBE2K Antibody
ABD6231 100 ug
EUR 438
UBE2K antibody
38184-100ul 100ul
EUR 252
UBE2K Antibody
DF6231 200ul
EUR 304
Description: UBE2K Antibody detects endogenous levels of total UBE2K.
UBE2K Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2K. Recognizes UBE2K from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:50-1:200, IF:1:50-1:500
UBE2K Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2K. Recognizes UBE2K from Human. This antibody is Unconjugated. Tested in the following application: ELISA
UBE2K Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against UBE2K. Recognizes UBE2K from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
Polyclonal UBE2K Antibody(N-term)
APR13900G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UBE2K (N-term). This antibody is tested and proven to work in the following applications:
UBE2K Polyclonal Antibody, Biotin Conjugated
A53453 100 µg
EUR 570.55
Description: Ask the seller for details
UBE2K Polyclonal Antibody, FITC Conjugated
A53454 100 µg
EUR 570.55
Description: The best epigenetics products
UBE2K Polyclonal Antibody, HRP Conjugated
A53455 100 µg
EUR 570.55
Description: kits suitable for this type of research
Polyclonal UBE2K / LIG Antibody (C-Terminus)
APR13899G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human UBE2K / LIG (C-Terminus). This antibody is tested and proven to work in the following applications:
UBE2K Conjugated Antibody
C38184 100ul
EUR 397
anti- UBE2K antibody
FNab09178 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • Immunogen: ubiquitin-conjugating enzyme E2K
  • Uniprot ID: P61086
  • Gene ID: 3093
  • Research Area: Neuroscience, Immunology, Metabolism, Epigenetics
Description: Antibody raised against UBE2K
Anti-UBE2K antibody
PAab09178 100 ug
EUR 386
Anti-UBE2K antibody
STJ26018 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the ubiquitin-conjugating enzyme family. This protein interacts with RING finger proteins, and it can ubiquitinate huntingtin, the gene product for Huntington's disease. Known functions for this protein include a role in aggregate formation of expanded polyglutamine proteins and the suppression of apoptosis in polyglutamine diseases, a role in the dislocation of newly synthesized MHC class I heavy chains from the endoplasmic reticulum, and involvement in foam cell formation. Multiple transcript variants encoding different isoforms have been identified for this gene.
Anti-UBE2K antibody
STJ26019 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the ubiquitin-conjugating enzyme family. This protein interacts with RING finger proteins, and it can ubiquitinate huntingtin, the gene product for Huntington's disease. Known functions for this protein include a role in aggregate formation of expanded polyglutamine proteins and the suppression of apoptosis in polyglutamine diseases, a role in the dislocation of newly synthesized MHC class I heavy chains from the endoplasmic reticulum, and involvement in foam cell formation. Multiple transcript variants encoding different isoforms have been identified for this gene.
Anti-UBE2K antibody
STJ191605 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to UBE2K
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UBE2K Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2K. Recognizes UBE2K from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
UBE2K Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2K. Recognizes UBE2K from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
UBE2K Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2K. Recognizes UBE2K from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
UBE2K Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2K. Recognizes UBE2K from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
UBE2K Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2K. Recognizes UBE2K from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
UBE2K Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UBE2K. Recognizes UBE2K from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
UBE2K cloning plasmid
CSB-CL025460HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 603
  • Sequence: atggccaacatcgcggtgcagcgaatcaagcgggagttcaaggaggtgctgaagagcgaggagacgagcaaaaatcaaattaaagtagatcttgtagatgagaattttacagaattaagaggagaaatagcaggacctccagacacaccatatgaaggaggaagataccaactaga
  • Show more
Description: A cloning plasmid for the UBE2K gene.
UBE2K Blocking Peptide
33R-3087 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UBE2K antibody, catalog no. 70R-9579
UBE2K Blocking Peptide
33R-7744 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UBE2K antibody, catalog no. 70R-2724
UBE2K Blocking Peptide
33R-9361 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UBE2K antibody, catalog no. 70R-9580
UBE2K Blocking Peptide
DF6231-BP 1mg
EUR 195
Mouse UBE2K shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
EF004006 96 Tests
EUR 689

UBE2K Rabbit Polyclonal Antibody