UBE2K Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
UBE2K Polyclonal Antibody |
A57858 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
UBE2K Polyclonal Antibody |
A53456 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
UBE2K Polyclonal Antibody |
ABP60821-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human UBE2K protein
- Applications tips:
|
Description: A polyclonal antibody for detection of UBE2K from Human, Mouse. This UBE2K antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBE2K protein |
UBE2K Polyclonal Antibody |
ABP60821-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human UBE2K protein
- Applications tips:
|
Description: A polyclonal antibody for detection of UBE2K from Human, Mouse. This UBE2K antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBE2K protein |
UBE2K Polyclonal Antibody |
ABP60821-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human UBE2K protein
- Applications tips:
|
Description: A polyclonal antibody for detection of UBE2K from Human, Mouse. This UBE2K antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBE2K protein |
UBE2K Polyclonal Antibody |
ES10447-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against UBE2K from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
UBE2K Polyclonal Antibody |
ES10447-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against UBE2K from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
UBE2K Rabbit pAb |
A1086-100ul |
Abclonal |
100 ul |
EUR 308 |
UBE2K Rabbit pAb |
A1086-200ul |
Abclonal |
200 ul |
EUR 459 |
UBE2K Rabbit pAb |
A1086-20ul |
Abclonal |
20 ul |
EUR 183 |
UBE2K Rabbit pAb |
A1086-50ul |
Abclonal |
50 ul |
EUR 223 |
UBE2K Rabbit pAb |
A0655-100ul |
Abclonal |
100 ul |
EUR 308 |
UBE2K Rabbit pAb |
A0655-200ul |
Abclonal |
200 ul |
EUR 459 |
UBE2K Rabbit pAb |
A0655-20ul |
Abclonal |
20 ul |
Ask for price |
UBE2K Rabbit pAb |
A0655-50ul |
Abclonal |
50 ul |
Ask for price |
UBE2K antibody |
70R-21107 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal UBE2K antibody |
UBE2K antibody |
70R-2724 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal UBE2K antibody |
UBE2K antibody |
38184-100ul |
SAB |
100ul |
EUR 252 |
UBE2K Antibody |
1-CSB-PA09667A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UBE2K. Recognizes UBE2K from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:50-1:200, IF:1:50-1:500 |
UBE2K Antibody |
1-CSB-PA09669A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UBE2K. Recognizes UBE2K from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
UBE2K Antibody |
DF6231 |
Affbiotech |
200ul |
EUR 304 |
Description: UBE2K Antibody detects endogenous levels of total UBE2K. |
UBE2K antibody |
70R-9579 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal UBE2K antibody |
UBE2K antibody |
70R-9580 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal UBE2K antibody |
UBE2K Antibody |
1-CSB-PA025460GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against UBE2K. Recognizes UBE2K from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
Polyclonal UBE2K Antibody(N-term) |
APR13900G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UBE2K (N-term). This antibody is tested and proven to work in the following applications: |
UBE2K Polyclonal Antibody, Biotin Conjugated |
A53453 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
UBE2K Polyclonal Antibody, FITC Conjugated |
A53454 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
UBE2K Polyclonal Antibody, HRP Conjugated |
A53455 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
Polyclonal UBE2K / LIG Antibody (C-Terminus) |
APR13899G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human UBE2K / LIG (C-Terminus). This antibody is tested and proven to work in the following applications: |
UBE2K Conjugated Antibody |
C38184 |
SAB |
100ul |
EUR 397 |
anti- UBE2K antibody |
FNab09178 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:2000
- IHC: 1:20-1:200
- Immunogen: ubiquitin-conjugating enzyme E2K
- Uniprot ID: P61086
- Gene ID: 3093
- Research Area: Neuroscience, Immunology, Metabolism, Epigenetics
|
Description: Antibody raised against UBE2K |
Anti-UBE2K antibody |
STJ26018 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene belongs to the ubiquitin-conjugating enzyme family. This protein interacts with RING finger proteins, and it can ubiquitinate huntingtin, the gene product for Huntington's disease. Known functions for this protein include a role in aggregate formation of expanded polyglutamine proteins and the suppression of apoptosis in polyglutamine diseases, a role in the dislocation of newly synthesized MHC class I heavy chains from the endoplasmic reticulum, and involvement in foam cell formation. Multiple transcript variants encoding different isoforms have been identified for this gene. |
Anti-UBE2K antibody |
STJ26019 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene belongs to the ubiquitin-conjugating enzyme family. This protein interacts with RING finger proteins, and it can ubiquitinate huntingtin, the gene product for Huntington's disease. Known functions for this protein include a role in aggregate formation of expanded polyglutamine proteins and the suppression of apoptosis in polyglutamine diseases, a role in the dislocation of newly synthesized MHC class I heavy chains from the endoplasmic reticulum, and involvement in foam cell formation. Multiple transcript variants encoding different isoforms have been identified for this gene. |
Anti-UBE2K antibody |
STJ191605 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to UBE2K |
UBE2K siRNA |
20-abx938788 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
UBE2K siRNA |
20-abx938789 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
UBE2K Antibody, HRP conjugated |
1-CSB-PA09667B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UBE2K. Recognizes UBE2K from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
UBE2K Antibody, FITC conjugated |
1-CSB-PA09667C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UBE2K. Recognizes UBE2K from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
UBE2K Antibody, Biotin conjugated |
1-CSB-PA09667D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UBE2K. Recognizes UBE2K from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
UBE2K Antibody, HRP conjugated |
1-CSB-PA09669B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UBE2K. Recognizes UBE2K from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
UBE2K Antibody, FITC conjugated |
1-CSB-PA09669C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UBE2K. Recognizes UBE2K from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
UBE2K Antibody, Biotin conjugated |
1-CSB-PA09669D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UBE2K. Recognizes UBE2K from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
UBE2K Blocking Peptide |
33R-3087 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UBE2K antibody, catalog no. 70R-9579 |
UBE2K Blocking Peptide |
33R-9361 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UBE2K antibody, catalog no. 70R-9580 |
UBE2K Blocking Peptide |
33R-7744 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UBE2K antibody, catalog no. 70R-2724 |
UBE2K Blocking Peptide |
DF6231-BP |
Affbiotech |
1mg |
EUR 195 |
UBE2K cloning plasmid |
CSB-CL025460HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 603
- Sequence: atggccaacatcgcggtgcagcgaatcaagcgggagttcaaggaggtgctgaagagcgaggagacgagcaaaaatcaaattaaagtagatcttgtagatgagaattttacagaattaagaggagaaatagcaggacctccagacacaccatatgaaggaggaagataccaactaga
- Show more
|
Description: A cloning plasmid for the UBE2K gene. |
UBE2K protein (His tag) |
80R-1652 |
Fitzgerald |
50 ug |
EUR 397 |
Description: Purified recombinant Human UBE2K protein |
UBE2K Rabbit Polyclonal Antibody