UVRAG Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
UVRAG Polyclonal Antibody |
ABP60866-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human UVRAG protein
- Applications tips:
|
Description: A polyclonal antibody for detection of UVRAG from Human. This UVRAG antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UVRAG protein |
UVRAG Polyclonal Antibody |
ABP60866-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human UVRAG protein
- Applications tips:
|
Description: A polyclonal antibody for detection of UVRAG from Human. This UVRAG antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UVRAG protein |
UVRAG Polyclonal Antibody |
ABP60866-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human UVRAG protein
- Applications tips:
|
Description: A polyclonal antibody for detection of UVRAG from Human. This UVRAG antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UVRAG protein |
UVRAG Polyclonal Antibody |
31556-100ul |
SAB |
100ul |
EUR 252 |
UVRAG Polyclonal Antibody |
31556-50ul |
SAB |
50ul |
EUR 187 |
UVRAG Rabbit pAb |
A8462-100ul |
Abclonal |
100 ul |
EUR 308 |
UVRAG Rabbit pAb |
A8462-200ul |
Abclonal |
200 ul |
EUR 459 |
UVRAG Rabbit pAb |
A8462-20ul |
Abclonal |
20 ul |
EUR 183 |
UVRAG Rabbit pAb |
A8462-50ul |
Abclonal |
50 ul |
EUR 223 |
UVRAG Polyclonal Conjugated Antibody |
C31556 |
SAB |
100ul |
EUR 397 |
UVRAG antibody |
70R-21226 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal UVRAG antibody |
UVRAG Antibody |
1-CSB-PA882187HA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UVRAG. Recognizes UVRAG from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200 |
UVRAG Antibody |
1-CSB-PA025776GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against UVRAG. Recognizes UVRAG from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF |
Polyclonal UVRAG Antibody (C-Terminus) |
APR03194G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UVRAG (C-Terminus). This antibody is tested and proven to work in the following applications: |
Polyclonal UVRAG Antibody (C-term L555) |
APR04324G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UVRAG (C-term L555). This antibody is tested and proven to work in the following applications: |
anti- UVRAG antibody |
FNab09352 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:100
- Immunogen: UV radiation resistance associated gene
- Uniprot ID: Q9P2Y5
- Gene ID: 7405
- Research Area: Cardiovascular, Metabolism
|
Description: Antibody raised against UVRAG |
Anti-UVRAG antibody |
STJ110760 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene complements the ultraviolet sensitivity of xeroderma pigmentosum group C cells and encodes a protein with a C2 domain. The protein activates the Beclin1-PI(3)KC3 complex, promoting autophagy and suppressing the proliferation and tumorigenicity of human colon cancer cells. Chromosomal aberrations involving this gene are associated with left-right axis malformation and mutations in this gene have been associated with colon cancer. |
Anti-UVRAG antibody |
STJ192029 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to UVRAG |
UVRAG siRNA |
20-abx939299 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-UVRAG |
YF-PA15253 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to UVRAG |
anti-UVRAG |
YF-PA15254 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to UVRAG |
UVRAG Antibody, HRP conjugated |
1-CSB-PA882187HB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UVRAG. Recognizes UVRAG from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
UVRAG Antibody, FITC conjugated |
1-CSB-PA882187HC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UVRAG. Recognizes UVRAG from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
UVRAG Antibody, Biotin conjugated |
1-CSB-PA882187HD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against UVRAG. Recognizes UVRAG from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Antibody for Human UVRAG |
SPC-605D |
Stressmarq |
0.1mg |
EUR 354 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is unconjugated. |
Antibody for Human UVRAG |
SPC-605D-A390 |
Stressmarq |
0.1mg |
EUR 401 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 390. |
Antibody for Human UVRAG |
SPC-605D-A488 |
Stressmarq |
0.1mg |
EUR 400 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 488. |
Antibody for Human UVRAG |
SPC-605D-A565 |
Stressmarq |
0.1mg |
EUR 400 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 565. |
Antibody for Human UVRAG |
SPC-605D-A594 |
Stressmarq |
0.1mg |
EUR 400 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 594. |
Antibody for Human UVRAG |
SPC-605D-A633 |
Stressmarq |
0.1mg |
EUR 400 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 633. |
Antibody for Human UVRAG |
SPC-605D-A655 |
Stressmarq |
0.1mg |
EUR 400 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 655. |
Antibody for Human UVRAG |
SPC-605D-A680 |
Stressmarq |
0.1mg |
EUR 400 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 680. |
Antibody for Human UVRAG |
SPC-605D-A700 |
Stressmarq |
0.1mg |
EUR 400 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 700. |
Antibody for Human UVRAG |
SPC-605D-ALP |
Stressmarq |
0.1mg |
EUR 394 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Alkaline Phosphatase. |
Antibody for Human UVRAG |
SPC-605D-APC |
Stressmarq |
0.1mg |
EUR 399 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to APC . |
Antibody for Human UVRAG |
SPC-605D-APCCY7 |
Stressmarq |
0.1mg |
EUR 471 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to APC/Cy7. |
Antibody for Human UVRAG |
SPC-605D-BI |
Stressmarq |
0.1mg |
EUR 396 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Biotin. |
Antibody for Human UVRAG |
SPC-605D-DY350 |
Stressmarq |
0.1mg |
EUR 414 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 350. |
Antibody for Human UVRAG |
SPC-605D-DY405 |
Stressmarq |
0.1mg |
EUR 403 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 405. |
Antibody for Human UVRAG |
SPC-605D-DY488 |
Stressmarq |
0.1mg |
EUR 393 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 488. |
Antibody for Human UVRAG |
SPC-605D-DY594 |
Stressmarq |
0.1mg |
EUR 395 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 594. |
Antibody for Human UVRAG |
SPC-605D-DY633 |
Stressmarq |
0.1mg |
EUR 390 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 633. |
Antibody for Human UVRAG |
SPC-605D-FITC |
Stressmarq |
0.1mg |
EUR 392 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to FITC. |
Antibody for Human UVRAG |
SPC-605D-HRP |
Stressmarq |
0.1mg |
EUR 388 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to HRP. |
Antibody for Human UVRAG |
SPC-605D-P594 |
Stressmarq |
0.1mg |
EUR 407 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to PE/ATTO 594. |
Antibody for Human UVRAG |
SPC-605D-PCP |
Stressmarq |
0.1mg |
EUR 399 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to PerCP. |
Antibody for Human UVRAG |
SPC-605D-RPE |
Stressmarq |
0.1mg |
EUR 397 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to RPE . |
Antibody for Human UVRAG |
SPC-605D-STR |
Stressmarq |
0.1mg |
EUR 398 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Streptavidin. |
Antibody for Human UVRAG |
SPC-605S |
Stressmarq |
0.012mg |
EUR 65 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is unconjugated. |
Antibody for Human UVRAG |
SPC-606D |
Stressmarq |
0.1mg |
EUR 354 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is unconjugated. |
Antibody for Human UVRAG |
SPC-606D-A390 |
Stressmarq |
0.1mg |
EUR 401 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 390. |
Antibody for Human UVRAG |
SPC-606D-A488 |
Stressmarq |
0.1mg |
EUR 400 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 488. |
Antibody for Human UVRAG |
SPC-606D-A565 |
Stressmarq |
0.1mg |
EUR 400 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 565. |
Antibody for Human UVRAG |
SPC-606D-A594 |
Stressmarq |
0.1mg |
EUR 400 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 594. |
Antibody for Human UVRAG |
SPC-606D-A633 |
Stressmarq |
0.1mg |
EUR 400 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 633. |
Antibody for Human UVRAG |
SPC-606D-A655 |
Stressmarq |
0.1mg |
EUR 400 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 655. |
Antibody for Human UVRAG |
SPC-606D-A680 |
Stressmarq |
0.1mg |
EUR 400 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 680. |
Antibody for Human UVRAG |
SPC-606D-A700 |
Stressmarq |
0.1mg |
EUR 400 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 700. |
Antibody for Human UVRAG |
SPC-606D-ALP |
Stressmarq |
0.1mg |
EUR 394 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Alkaline Phosphatase. |
Antibody for Human UVRAG |
SPC-606D-APC |
Stressmarq |
0.1mg |
EUR 399 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to APC . |
Antibody for Human UVRAG |
SPC-606D-APCCY7 |
Stressmarq |
0.1mg |
EUR 471 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to APC/Cy7. |
Antibody for Human UVRAG |
SPC-606D-BI |
Stressmarq |
0.1mg |
EUR 396 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Biotin. |
Antibody for Human UVRAG |
SPC-606D-DY350 |
Stressmarq |
0.1mg |
EUR 414 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 350. |
Antibody for Human UVRAG |
SPC-606D-DY405 |
Stressmarq |
0.1mg |
EUR 403 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 405. |
Antibody for Human UVRAG |
SPC-606D-DY488 |
Stressmarq |
0.1mg |
EUR 393 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 488. |
Antibody for Human UVRAG |
SPC-606D-DY594 |
Stressmarq |
0.1mg |
EUR 395 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 594. |
Antibody for Human UVRAG |
SPC-606D-DY633 |
Stressmarq |
0.1mg |
EUR 390 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 633. |
Antibody for Human UVRAG |
SPC-606D-FITC |
Stressmarq |
0.1mg |
EUR 392 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to FITC. |
Antibody for Human UVRAG |
SPC-606D-HRP |
Stressmarq |
0.1mg |
EUR 388 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to HRP. |
Antibody for Human UVRAG |
SPC-606D-P594 |
Stressmarq |
0.1mg |
EUR 407 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to PE/ATTO 594. |
Antibody for Human UVRAG |
SPC-606D-PCP |
Stressmarq |
0.1mg |
EUR 399 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to PerCP. |
Antibody for Human UVRAG |
SPC-606D-RPE |
Stressmarq |
0.1mg |
EUR 397 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to RPE . |
Antibody for Human UVRAG |
SPC-606D-STR |
Stressmarq |
0.1mg |
EUR 398 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Streptavidin. |
Antibody for Human UVRAG |
SPC-606S |
Stressmarq |
0.012mg |
EUR 65 |
- UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
- Show more
|
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is unconjugated. |
UVRAG cloning plasmid |
CSB-CL882187HU-10ug |
Cusabio |
10ug |
EUR 698 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2100
- Sequence: atgagcgcctccgcgtcggtcgggggccaggtcccccagccacccccgggcccggccgctgctctgcctcccggttctgccgcgcgggccctgcatgtggagctgccgtctcagcagcggcgtcttcgacatcttcggaacattgctgcccggaacattgttaatagaaatggcc
- Show more
|
Description: A cloning plasmid for the UVRAG gene. |
Anti-UVRAG (2E8) |
YF-MA16038 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to UVRAG |
Human UVRAG shRNA Plasmid |
20-abx955065 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
UVRAG Recombinant Protein (Human) |
RP034189 |
ABM |
100 ug |
Ask for price |
UVRAG Recombinant Protein (Rat) |
RP236216 |
ABM |
100 ug |
Ask for price |
UVRAG Recombinant Protein (Mouse) |
RP183581 |
ABM |
100 ug |
Ask for price |
Uv Radiation Resistance Associated Gene (UVRAG) Antibody |
20-abx116558 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Uvrag ORF Vector (Rat) (pORF) |
ORF078740 |
ABM |
1.0 ug DNA |
EUR 506 |
UVRAG ORF Vector (Human) (pORF) |
ORF011397 |
ABM |
1.0 ug DNA |
EUR 95 |
Uvrag ORF Vector (Mouse) (pORF) |
ORF061195 |
ABM |
1.0 ug DNA |
EUR 506 |
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody |
20-abx006162 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody |
abx030355-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody |
abx030355-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody |
abx030356-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody |
abx030356-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody |
abx030357-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody |
abx030357-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody |
abx030358-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody |
abx030358-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody |
20-abx313923 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody |
abx448488-100ug |
Abbexa |
100 ug |
EUR 523 |
- Shipped within 5-12 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody |
abx448489-100ug |
Abbexa |
100 ug |
EUR 523 |
- Shipped within 5-12 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody |
abx239352-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
UVRAG sgRNA CRISPR Lentivector set (Human) |
K2604001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Uvrag sgRNA CRISPR Lentivector set (Mouse) |
K4705601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Uvrag sgRNA CRISPR Lentivector set (Rat) |
K6716701 |
ABM |
3 x 1.0 ug |
EUR 339 |
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (HRP) |
20-abx313924 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (FITC) |
20-abx313925 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (Biotin) |
20-abx313926 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ALP) |
abx446398-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ALP) |
abx446399-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (APC) |
abx446400-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (APC) |
abx446401-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (Biotin) |
abx446402-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (Biotin) |
abx446403-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (FITC) |
abx446404-100ug |
Abbexa |
100 ug |
EUR 565 |
- Shipped within 5-12 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (FITC) |
abx446405-100ug |
Abbexa |
100 ug |
EUR 565 |
- Shipped within 5-12 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (HRP) |
abx446406-100ug |
Abbexa |
100 ug |
EUR 565 |
- Shipped within 5-12 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (HRP) |
abx446407-100ug |
Abbexa |
100 ug |
EUR 565 |
- Shipped within 5-12 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (PerCP) |
abx446410-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (PerCP) |
abx446411-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (RPE) |
abx446412-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (RPE) |
abx446413-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (Streptavidin) |
abx446414-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (Streptavidin) |
abx446415-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
UVRAG sgRNA CRISPR Lentivector (Human) (Target 1) |
K2604002 |
ABM |
1.0 ug DNA |
EUR 154 |
UVRAG sgRNA CRISPR Lentivector (Human) (Target 2) |
K2604003 |
ABM |
1.0 ug DNA |
EUR 154 |
UVRAG sgRNA CRISPR Lentivector (Human) (Target 3) |
K2604004 |
ABM |
1.0 ug DNA |
EUR 154 |
Uvrag sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4705602 |
ABM |
1.0 ug DNA |
EUR 154 |
Uvrag sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4705603 |
ABM |
1.0 ug DNA |
EUR 154 |
Uvrag sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4705604 |
ABM |
1.0 ug DNA |
EUR 154 |
Uvrag sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6716702 |
ABM |
1.0 ug DNA |
EUR 154 |
Uvrag sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6716703 |
ABM |
1.0 ug DNA |
EUR 154 |
Uvrag sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6716704 |
ABM |
1.0 ug DNA |
EUR 154 |
UVRAG Protein Vector (Human) (pPB-C-His) |
PV045585 |
ABM |
500 ng |
EUR 329 |
UVRAG Protein Vector (Human) (pPB-N-His) |
PV045586 |
ABM |
500 ng |
EUR 329 |
UVRAG Protein Vector (Human) (pPM-C-HA) |
PV045587 |
ABM |
500 ng |
EUR 329 |
UVRAG Protein Vector (Human) (pPM-C-His) |
PV045588 |
ABM |
500 ng |
EUR 329 |
UVRAG Protein Vector (Rat) (pPB-C-His) |
PV314958 |
ABM |
500 ng |
EUR 603 |
UVRAG Protein Vector (Rat) (pPB-N-His) |
PV314959 |
ABM |
500 ng |
EUR 603 |
UVRAG Protein Vector (Rat) (pPM-C-HA) |
PV314960 |
ABM |
500 ng |
EUR 603 |
UVRAG Protein Vector (Rat) (pPM-C-His) |
PV314961 |
ABM |
500 ng |
EUR 603 |
UVRAG Protein Vector (Mouse) (pPB-C-His) |
PV244778 |
ABM |
500 ng |
EUR 1065 |
UVRAG Protein Vector (Mouse) (pPB-N-His) |
PV244779 |
ABM |
500 ng |
EUR 1065 |
UVRAG Protein Vector (Mouse) (pPM-C-HA) |
PV244780 |
ABM |
500 ng |
EUR 1065 |
UVRAG Protein Vector (Mouse) (pPM-C-His) |
PV244781 |
ABM |
500 ng |
EUR 1065 |
Uvrag 3'UTR GFP Stable Cell Line |
TU171711 |
ABM |
1.0 ml |
Ask for price |
UVRAG 3'UTR GFP Stable Cell Line |
TU078037 |
ABM |
1.0 ml |
EUR 2333 |
Uvrag 3'UTR Luciferase Stable Cell Line |
TU121711 |
ABM |
1.0 ml |
Ask for price |
UVRAG 3'UTR Luciferase Stable Cell Line |
TU028037 |
ABM |
1.0 ml |
EUR 2333 |
Uvrag 3'UTR Luciferase Stable Cell Line |
TU222982 |
ABM |
1.0 ml |
Ask for price |
Uvrag 3'UTR GFP Stable Cell Line |
TU272982 |
ABM |
1.0 ml |
Ask for price |
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 390) |
abx446382-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 390) |
abx446383-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 488) |
abx446384-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 488) |
abx446385-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 565) |
abx446386-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 565) |
abx446387-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 594) |
abx446388-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 594) |
abx446389-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 633) |
abx446390-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 633) |
abx446391-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 655) |
abx446392-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 655) |
abx446393-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 680) |
abx446394-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 680) |
abx446395-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 700) |
abx446396-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 700) |
abx446397-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
UVRAG Rabbit Polyclonal Antibody