UVRAG Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

UVRAG Polyclonal Antibody
ABP60866-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human UVRAG protein
  • Applications tips:
Description: A polyclonal antibody for detection of UVRAG from Human. This UVRAG antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UVRAG protein

UVRAG Polyclonal Antibody
ABP60866-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human UVRAG protein
  • Applications tips:
Description: A polyclonal antibody for detection of UVRAG from Human. This UVRAG antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UVRAG protein

UVRAG Polyclonal Antibody
ABP60866-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human UVRAG protein
  • Applications tips:
Description: A polyclonal antibody for detection of UVRAG from Human. This UVRAG antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UVRAG protein

UVRAG Polyclonal Antibody
ES10871-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against UVRAG from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

UVRAG Polyclonal Antibody
ES10871-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against UVRAG from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

UVRAG Rabbit pAb
A8462-100ul 100 ul
EUR 308

UVRAG Rabbit pAb
A8462-200ul 200 ul
EUR 459

UVRAG Rabbit pAb
A8462-20ul 20 ul
EUR 183

UVRAG Rabbit pAb
A8462-50ul 50 ul
EUR 223

UVRAG Polyclonal Conjugated Antibody
C31556 100ul
EUR 397

UVRAG antibody
70R-21226 50 ul
EUR 435
Description: Rabbit polyclonal UVRAG antibody

UVRAG Antibody
1-CSB-PA882187HA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UVRAG. Recognizes UVRAG from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

UVRAG Antibody
1-CSB-PA025776GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against UVRAG. Recognizes UVRAG from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

Polyclonal UVRAG Antibody (C-Terminus)
APR03194G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UVRAG (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal UVRAG Antibody (C-term L555)
APR04324G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UVRAG (C-term L555). This antibody is tested and proven to work in the following applications:

anti- UVRAG antibody
FNab09352 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:100
  • Immunogen: UV radiation resistance associated gene
  • Uniprot ID: Q9P2Y5
  • Gene ID: 7405
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against UVRAG

Anti-UVRAG antibody
PAab09352 100 ug
EUR 386

Anti-UVRAG antibody
STJ110760 100 µl
EUR 277
Description: This gene complements the ultraviolet sensitivity of xeroderma pigmentosum group C cells and encodes a protein with a C2 domain. The protein activates the Beclin1-PI(3)KC3 complex, promoting autophagy and suppressing the proliferation and tumorigenicity of human colon cancer cells. Chromosomal aberrations involving this gene are associated with left-right axis malformation and mutations in this gene have been associated with colon cancer.

Anti-UVRAG antibody
STJ192029 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to UVRAG

UVRAG siRNA
20-abx939299
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-UVRAG
YF-PA15253 50 ul
EUR 363
Description: Mouse polyclonal to UVRAG

anti-UVRAG
YF-PA15254 50 ug
EUR 363
Description: Mouse polyclonal to UVRAG

UVRAG Antibody, HRP conjugated
1-CSB-PA882187HB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UVRAG. Recognizes UVRAG from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

UVRAG Antibody, FITC conjugated
1-CSB-PA882187HC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UVRAG. Recognizes UVRAG from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

UVRAG Antibody, Biotin conjugated
1-CSB-PA882187HD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UVRAG. Recognizes UVRAG from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Antibody for Human UVRAG
SPC-605D 0.1mg
EUR 354
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is unconjugated.

Antibody for Human UVRAG
SPC-605D-A390 0.1mg
EUR 401
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 390.

Antibody for Human UVRAG
SPC-605D-A488 0.1mg
EUR 400
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 488.

Antibody for Human UVRAG
SPC-605D-A565 0.1mg
EUR 400
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 565.

Antibody for Human UVRAG
SPC-605D-A594 0.1mg
EUR 400
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 594.

Antibody for Human UVRAG
SPC-605D-A633 0.1mg
EUR 400
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 633.

Antibody for Human UVRAG
SPC-605D-A655 0.1mg
EUR 400
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 655.

Antibody for Human UVRAG
SPC-605D-A680 0.1mg
EUR 400
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 680.

Antibody for Human UVRAG
SPC-605D-A700 0.1mg
EUR 400
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 700.

Antibody for Human UVRAG
SPC-605D-ALP 0.1mg
EUR 394
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Alkaline Phosphatase.

Antibody for Human UVRAG
SPC-605D-APC 0.1mg
EUR 399
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to APC .

Antibody for Human UVRAG
SPC-605D-APCCY7 0.1mg
EUR 471
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to APC/Cy7.

Antibody for Human UVRAG
SPC-605D-BI 0.1mg
EUR 396
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Biotin.

Antibody for Human UVRAG
SPC-605D-DY350 0.1mg
EUR 414
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 350.

Antibody for Human UVRAG
SPC-605D-DY405 0.1mg
EUR 403
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 405.

Antibody for Human UVRAG
SPC-605D-DY488 0.1mg
EUR 393
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 488.

Antibody for Human UVRAG
SPC-605D-DY594 0.1mg
EUR 395
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 594.

Antibody for Human UVRAG
SPC-605D-DY633 0.1mg
EUR 390
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 633.

Antibody for Human UVRAG
SPC-605D-FITC 0.1mg
EUR 392
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to FITC.

Antibody for Human UVRAG
SPC-605D-HRP 0.1mg
EUR 388
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to HRP.

Antibody for Human UVRAG
SPC-605D-P594 0.1mg
EUR 407
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to PE/ATTO 594.

Antibody for Human UVRAG
SPC-605D-PCP 0.1mg
EUR 399
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to PerCP.

Antibody for Human UVRAG
SPC-605D-RPE 0.1mg
EUR 397
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to RPE .

Antibody for Human UVRAG
SPC-605D-STR 0.1mg
EUR 398
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Streptavidin.

Antibody for Human UVRAG
SPC-605S 0.012mg
EUR 65
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is unconjugated.

Antibody for Human UVRAG
SPC-606D 0.1mg
EUR 354
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is unconjugated.

Antibody for Human UVRAG
SPC-606D-A390 0.1mg
EUR 401
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 390.

Antibody for Human UVRAG
SPC-606D-A488 0.1mg
EUR 400
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 488.

Antibody for Human UVRAG
SPC-606D-A565 0.1mg
EUR 400
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 565.

Antibody for Human UVRAG
SPC-606D-A594 0.1mg
EUR 400
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 594.

Antibody for Human UVRAG
SPC-606D-A633 0.1mg
EUR 400
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 633.

Antibody for Human UVRAG
SPC-606D-A655 0.1mg
EUR 400
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 655.

Antibody for Human UVRAG
SPC-606D-A680 0.1mg
EUR 400
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 680.

Antibody for Human UVRAG
SPC-606D-A700 0.1mg
EUR 400
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 700.

Antibody for Human UVRAG
SPC-606D-ALP 0.1mg
EUR 394
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Alkaline Phosphatase.

Antibody for Human UVRAG
SPC-606D-APC 0.1mg
EUR 399
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to APC .

Antibody for Human UVRAG
SPC-606D-APCCY7 0.1mg
EUR 471
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to APC/Cy7.

Antibody for Human UVRAG
SPC-606D-BI 0.1mg
EUR 396
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Biotin.

Antibody for Human UVRAG
SPC-606D-DY350 0.1mg
EUR 414
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 350.

Antibody for Human UVRAG
SPC-606D-DY405 0.1mg
EUR 403
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 405.

Antibody for Human UVRAG
SPC-606D-DY488 0.1mg
EUR 393
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 488.

Antibody for Human UVRAG
SPC-606D-DY594 0.1mg
EUR 395
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 594.

Antibody for Human UVRAG
SPC-606D-DY633 0.1mg
EUR 390
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 633.

Antibody for Human UVRAG
SPC-606D-FITC 0.1mg
EUR 392
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to FITC.

Antibody for Human UVRAG
SPC-606D-HRP 0.1mg
EUR 388
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to HRP.

Antibody for Human UVRAG
SPC-606D-P594 0.1mg
EUR 407
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to PE/ATTO 594.

Antibody for Human UVRAG
SPC-606D-PCP 0.1mg
EUR 399
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to PerCP.

Antibody for Human UVRAG
SPC-606D-RPE 0.1mg
EUR 397
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to RPE .

Antibody for Human UVRAG
SPC-606D-STR 0.1mg
EUR 398
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Streptavidin.

Antibody for Human UVRAG
SPC-606S 0.012mg
EUR 65
  • UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation
  • Show more
Description: A polyclonal antibody for UVRAG from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is unconjugated.

UVRAG cloning plasmid
CSB-CL882187HU-10ug 10ug
EUR 698
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2100
  • Sequence: atgagcgcctccgcgtcggtcgggggccaggtcccccagccacccccgggcccggccgctgctctgcctcccggttctgccgcgcgggccctgcatgtggagctgccgtctcagcagcggcgtcttcgacatcttcggaacattgctgcccggaacattgttaatagaaatggcc
  • Show more
Description: A cloning plasmid for the UVRAG gene.

Anti-UVRAG (2E8)
YF-MA16038 100 ug
EUR 363
Description: Mouse monoclonal to UVRAG

Human UVRAG ELISA KIT
ELI-28505h 96 Tests
EUR 824

UVRAG ELISA KIT|Human
EF004158 96 Tests
EUR 689

Human UVRAG shRNA Plasmid
20-abx955065
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

UVRAG Recombinant Protein (Rat)
RP236216 100 ug Ask for price

pEGFP-C3-UVRAG Plasmid
PVTB00334-2a 2 ug
EUR 356

UVRAG Recombinant Protein (Human)
RP034189 100 ug Ask for price

UVRAG Recombinant Protein (Mouse)
RP183581 100 ug Ask for price

Uv Radiation Resistance Associated Gene (UVRAG) Antibody
20-abx116558
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Uvrag ORF Vector (Mouse) (pORF)
ORF061195 1.0 ug DNA
EUR 506

Uvrag ORF Vector (Rat) (pORF)
ORF078740 1.0 ug DNA
EUR 506

UVRAG ORF Vector (Human) (pORF)
ORF011397 1.0 ug DNA
EUR 95

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
20-abx006162
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
abx030355-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
abx030355-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
abx030356-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
abx030356-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
abx030357-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
abx030357-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
abx030358-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
abx030358-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
abx239352-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
abx448488-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
abx448489-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
20-abx313923
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Uvrag sgRNA CRISPR Lentivector set (Rat)
K6716701 3 x 1.0 ug
EUR 339

UVRAG sgRNA CRISPR Lentivector set (Human)
K2604001 3 x 1.0 ug
EUR 339

Uvrag sgRNA CRISPR Lentivector set (Mouse)
K4705601 3 x 1.0 ug
EUR 339

p3*FLAG-Myc-CMV-UVRAG Plasmid
PVTB00364-2a 2 ug
EUR 356

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ALP)
abx446398-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ALP)
abx446399-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (APC)
abx446400-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (APC)
abx446401-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (Biotin)
abx446402-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (Biotin)
abx446403-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (FITC)
abx446404-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (FITC)
abx446405-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (HRP)
abx446406-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (HRP)
abx446407-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (PerCP)
abx446410-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (PerCP)
abx446411-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (RPE)
abx446412-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (RPE)
abx446413-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (Streptavidin)
abx446414-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (Streptavidin)
abx446415-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (HRP)
20-abx313924
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (FITC)
20-abx313925
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (Biotin)
20-abx313926
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Uvrag sgRNA CRISPR Lentivector (Rat) (Target 1)
K6716702 1.0 ug DNA
EUR 154

Uvrag sgRNA CRISPR Lentivector (Rat) (Target 2)
K6716703 1.0 ug DNA
EUR 154

Uvrag sgRNA CRISPR Lentivector (Rat) (Target 3)
K6716704 1.0 ug DNA
EUR 154

UVRAG sgRNA CRISPR Lentivector (Human) (Target 1)
K2604002 1.0 ug DNA
EUR 154

UVRAG sgRNA CRISPR Lentivector (Human) (Target 2)
K2604003 1.0 ug DNA
EUR 154

UVRAG sgRNA CRISPR Lentivector (Human) (Target 3)
K2604004 1.0 ug DNA
EUR 154

Uvrag sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4705602 1.0 ug DNA
EUR 154

Uvrag sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4705603 1.0 ug DNA
EUR 154

Uvrag sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4705604 1.0 ug DNA
EUR 154

UVRAG Protein Vector (Mouse) (pPB-C-His)
PV244778 500 ng
EUR 1065

UVRAG Protein Vector (Mouse) (pPB-N-His)
PV244779 500 ng
EUR 1065

UVRAG Protein Vector (Mouse) (pPM-C-HA)
PV244780 500 ng
EUR 1065

UVRAG Protein Vector (Mouse) (pPM-C-His)
PV244781 500 ng
EUR 1065

UVRAG Protein Vector (Rat) (pPB-C-His)
PV314958 500 ng
EUR 603

UVRAG Protein Vector (Rat) (pPB-N-His)
PV314959 500 ng
EUR 603

UVRAG Protein Vector (Rat) (pPM-C-HA)
PV314960 500 ng
EUR 603

UVRAG Protein Vector (Rat) (pPM-C-His)
PV314961 500 ng
EUR 603

UVRAG Protein Vector (Human) (pPB-C-His)
PV045585 500 ng
EUR 329

UVRAG Protein Vector (Human) (pPB-N-His)
PV045586 500 ng
EUR 329

UVRAG Protein Vector (Human) (pPM-C-HA)
PV045587 500 ng
EUR 329

UVRAG Protein Vector (Human) (pPM-C-His)
PV045588 500 ng
EUR 329

Uvrag 3'UTR Luciferase Stable Cell Line
TU121711 1.0 ml Ask for price

UVRAG 3'UTR GFP Stable Cell Line
TU078037 1.0 ml
EUR 2333

Uvrag 3'UTR GFP Stable Cell Line
TU171711 1.0 ml Ask for price

Uvrag 3'UTR Luciferase Stable Cell Line
TU222982 1.0 ml Ask for price

UVRAG 3'UTR Luciferase Stable Cell Line
TU028037 1.0 ml
EUR 2333

Uvrag 3'UTR GFP Stable Cell Line
TU272982 1.0 ml Ask for price

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 390)
abx446382-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 390)
abx446383-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 488)
abx446384-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 488)
abx446385-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 565)
abx446386-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 565)
abx446387-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 594)
abx446388-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 594)
abx446389-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 633)
abx446390-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 633)
abx446391-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 655)
abx446392-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 655)
abx446393-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 680)
abx446394-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 680)
abx446395-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 700)
abx446396-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 700)
abx446397-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody
ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody
ABP57570-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK3 Rabbit Polyclonal Antibody
ABP57572-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

MEK2 Rabbit Polyclonal Antibody
ABP57573-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody
ABP57573-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody
ABP57573-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK3 Rabbit Polyclonal Antibody
ABP57574-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody
ABP57574-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody
ABP57574-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

Nrf2 Rabbit Polyclonal Antibody
ABP57575-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody
ABP57575-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody
ABP57575-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

UVRAG Rabbit Polyclonal Antibody