VDAC3 Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
VDAC3 Polyclonal Antibody |
ES10469-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VDAC3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
VDAC3 Polyclonal Antibody |
ES10469-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VDAC3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
VDAC3 Rabbit pAb |
A10544-100ul |
Abclonal |
100 ul |
EUR 308 |
VDAC3 Rabbit pAb |
A10544-200ul |
Abclonal |
200 ul |
EUR 459 |
VDAC3 Rabbit pAb |
A10544-20ul |
Abclonal |
20 ul |
EUR 183 |
VDAC3 Rabbit pAb |
A10544-50ul |
Abclonal |
50 ul |
EUR 223 |
VDAC3 Rabbit pAb |
A4183-100ul |
Abclonal |
100 ul |
EUR 308 |
VDAC3 Rabbit pAb |
A4183-200ul |
Abclonal |
200 ul |
EUR 459 |
VDAC3 Rabbit pAb |
A4183-20ul |
Abclonal |
20 ul |
Ask for price |
VDAC3 Rabbit pAb |
A4183-50ul |
Abclonal |
50 ul |
Ask for price |
Polyclonal VDAC3 Antibody (Center) |
APR10708G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VDAC3 (Center). This antibody is tested and proven to work in the following applications: |
VDAC3 antibody |
70R-21249 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal VDAC3 antibody |
VDAC3 Antibody |
42830-100ul |
SAB |
100ul |
EUR 252 |
VDAC3 Antibody |
DF12499 |
Affbiotech |
200ul |
EUR 304 |
Description: VDAC3 antibody detects endogenous levels of VDAC3. |
VDAC3 Antibody |
1-CSB-PA162897 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against VDAC3. Recognizes VDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000 |
VDAC3 Antibody |
1-CSB-PA025827GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against VDAC3. Recognizes VDAC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
VDAC3 antibody |
70R-5050 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal VDAC3 antibody raised against the N terminal of VDAC3 |
VDAC3 antibody |
70R-5051 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal VDAC3 antibody raised against the N terminal of VDAC3 |
VDAC3 Conjugated Antibody |
C42830 |
SAB |
100ul |
EUR 397 |
anti- VDAC3 antibody |
FNab09388 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: voltage-dependent anion channel 3
- Uniprot ID: Q9Y277
- Gene ID: 7419
- Research Area: Signal Transduction, Cancer, Metabolism
|
Description: Antibody raised against VDAC3 |
anti- VDAC3 antibody |
FNab09389 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:200-1:2000
- IP: 1:200-1:1000
- IHC: 1:20-1:200
- Immunogen: voltage-dependent anion channel 3
- Uniprot ID: Q9Y277
- Gene ID: 7419
- Research Area: Signal Transduction, Cancer, Metabolism
|
Description: Antibody raised against VDAC3 |
Anti-VDAC3 antibody |
STJ26082 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a voltage-dependent anion channel (VDAC), and belongs to the mitochondrial porin family. VDACs are small, integral membrane proteins that traverse the outer mitochondrial membrane and conduct ATP and other small metabolites. They are known to bind several kinases of intermediary metabolism, thought to be involved in translocation of adenine nucleotides, and are hypothesized to form part of the mitochondrial permeability transition pore, which results in the release of cytochrome c at the onset of apoptotic cell death. Alternatively transcript variants encoding different isoforms have been described for this gene. |
Anti-VDAC3 antibody |
STJ112562 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a voltage-dependent anion channel (VDAC), and belongs to the mitochondrial porin family. VDACs are small, integral membrane proteins that traverse the outer mitochondrial membrane and conduct ATP and other small metabolites. They are known to bind several kinases of intermediary metabolism, thought to be involved in translocation of adenine nucleotides, and are hypothesized to form part of the mitochondrial permeability transition pore, which results in the release of cytochrome c at the onset of apoptotic cell death. Alternatively transcript variants encoding different isoforms have been described for this gene. |
Anti-VDAC3 antibody |
STJ191627 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to VDAC3 |
VDAC3 siRNA |
20-abx906017 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
VDAC3 siRNA |
20-abx939382 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
VDAC3 siRNA |
20-abx939383 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
VDAC3 Blocking Peptide |
33R-4733 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VDAC3 antibody, catalog no. 70R-5051 |
VDAC3 Blocking Peptide |
33R-8339 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of VDAC3 antibody, catalog no. 70R-5050 |
VDAC3 cloning plasmid |
CSB-CL896484HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 852
- Sequence: atgtgtaacacaccaacgtactgtgacctaggaaaggctgctaaggatgtcttcaacaaaggatatggctttggcatggtcaagatagacctgaaaaccaagtcttgtagtggagtggaattttctacttctggtcatgcttacactgatacagggaaagcatcaggcaacctaga
- Show more
|
Description: A cloning plasmid for the VDAC3 gene. |
VDAC3 Blocking Peptide |
DF12499-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-VDAC3 (1C6) |
YF-MA16053 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to VDAC3 |
Mouse VDAC3 shRNA Plasmid |
20-abx973357 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat VDAC3 shRNA Plasmid |
20-abx986791 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human VDAC3 shRNA Plasmid |
20-abx955076 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
VDAC3 Recombinant Protein (Rat) |
RP236342 |
ABM |
100 ug |
Ask for price |
VDAC3 Recombinant Protein (Human) |
RP034300 |
ABM |
100 ug |
Ask for price |
VDAC3 Recombinant Protein (Mouse) |
RP183728 |
ABM |
100 ug |
Ask for price |
VDAC3 Recombinant Protein (Mouse) |
RP183731 |
ABM |
100 ug |
Ask for price |
Voltage-Dependent Anion Channel 3 (VDAC3) Antibody |
20-abx116630 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Vdac3 ORF Vector (Mouse) (pORF) |
ORF061244 |
ABM |
1.0 ug DNA |
EUR 506 |
Vdac3 ORF Vector (Mouse) (pORF) |
ORF061245 |
ABM |
1.0 ug DNA |
EUR 506 |
Vdac3 ORF Vector (Rat) (pORF) |
ORF078782 |
ABM |
1.0 ug DNA |
EUR 506 |
VDAC3 ORF Vector (Human) (pORF) |
ORF011434 |
ABM |
1.0 ug DNA |
EUR 95 |
Vdac3 sgRNA CRISPR Lentivector set (Mouse) |
K5012201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Vdac3 sgRNA CRISPR Lentivector set (Rat) |
K7022001 |
ABM |
3 x 1.0 ug |
EUR 339 |
VDAC3 sgRNA CRISPR Lentivector set (Human) |
K2608701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Voltage-Dependent Anion-Selective Channel Protein 3 (VDAC3) Antibody |
20-abx003093 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Voltage-dependent anion-selective channel protein 3 (VDAC3) Antibody |
20-abx214237 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Voltage-Dependent Anion-Selective Channel Protein 3 (VDAC3) Antibody |
20-abx126771 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Voltage-Dependent Anion-Selective Channel Protein 3 (VDAC3) Antibody |
abx029276-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Voltage-Dependent Anion-Selective Channel Protein 3 (VDAC3) Antibody |
abx029276-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Voltage-Dependent Anion-Selective Channel Protein 3 (VDAC3) Antibody |
abx239389-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Vdac3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K5012202 |
ABM |
1.0 ug DNA |
EUR 154 |
Vdac3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K5012203 |
ABM |
1.0 ug DNA |
EUR 154 |
Vdac3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K5012204 |
ABM |
1.0 ug DNA |
EUR 154 |
Vdac3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7022002 |
ABM |
1.0 ug DNA |
EUR 154 |
Vdac3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7022003 |
ABM |
1.0 ug DNA |
EUR 154 |
Vdac3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7022004 |
ABM |
1.0 ug DNA |
EUR 154 |
VDAC3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2608702 |
ABM |
1.0 ug DNA |
EUR 154 |
VDAC3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2608703 |
ABM |
1.0 ug DNA |
EUR 154 |
VDAC3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2608704 |
ABM |
1.0 ug DNA |
EUR 154 |
VDAC3 Protein Vector (Mouse) (pPB-C-His) |
PV244974 |
ABM |
500 ng |
EUR 603 |
VDAC3 Protein Vector (Mouse) (pPB-N-His) |
PV244975 |
ABM |
500 ng |
EUR 603 |
VDAC3 Protein Vector (Mouse) (pPM-C-HA) |
PV244976 |
ABM |
500 ng |
EUR 603 |
VDAC3 Protein Vector (Mouse) (pPM-C-His) |
PV244977 |
ABM |
500 ng |
EUR 603 |
VDAC3 Protein Vector (Mouse) (pPB-C-His) |
PV244978 |
ABM |
500 ng |
EUR 603 |
VDAC3 Rabbit Polyclonal Antibody