ZBTB6 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

ZBTB6 Polyclonal Antibody

ABP60956-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ZBTB6 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ZBTB6 from Human, Mouse. This ZBTB6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ZBTB6 protein

ZBTB6 Polyclonal Antibody

ABP60956-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ZBTB6 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ZBTB6 from Human, Mouse. This ZBTB6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ZBTB6 protein

ZBTB6 Polyclonal Antibody

A61842 100 µg
EUR 570.55
Description: The best epigenetics products

ZBTB6 Rabbit pAb

A15136-100ul 100 ul
EUR 308

ZBTB6 Rabbit pAb

A15136-200ul 200 ul
EUR 459

ZBTB6 Rabbit pAb

A15136-20ul 20 ul
EUR 183

ZBTB6 Rabbit pAb

A15136-50ul 50 ul
EUR 223

ZBTB6 antibody

70R-8281 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal ZBTB6 antibody

ZBTB6   Antibody

47479-100ul 100ul
EUR 252

ZBTB6 Antibody

25245-100ul 100ul
EUR 390

ZBTB6 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ZBTB6. Recognizes ZBTB6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

ZBTB6 Polyclonal Antibody, Biotin Conjugated

A61843 100 µg
EUR 570.55
Description: kits suitable for this type of research

ZBTB6 Polyclonal Antibody, FITC Conjugated

A61844 100 µg
EUR 570.55
Description: fast delivery possible

ZBTB6 Polyclonal Antibody, HRP Conjugated

A61845 100 µg
EUR 570.55
Description: reagents widely cited

ZBTB6   Conjugated Antibody

C47479 100ul
EUR 397

ZBTB6 Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ZBTB6 Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ZBTB6 Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-ZBTB6 antibody

STJ117330 100 µl
EUR 277

Anti-ZBTB6 antibody

STJ191639 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ZBTB6


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA17205 50 ug
EUR 363
Description: Mouse polyclonal to ZBTB6

ZBTB6 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ZBTB6. Recognizes ZBTB6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ZBTB6 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ZBTB6. Recognizes ZBTB6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ZBTB6 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ZBTB6. Recognizes ZBTB6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ZBTB6 Blocking Peptide

33R-5593 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ZBTB6 antibody, catalog no. 70R-8281

ZBTB6 cloning plasmid

CSB-CL621889HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1275
  • Sequence: atggctgctgagtctgatgttctgcatttccagtttgaacagcaaggagatgtggtcttgcagaaaatgaatcttttgagacagcagaatttattttgtgatgtatcaatttacattaatgacactgagttccaggggcacaaggtgattttggctgcttgctccacttttatga
  • Show more
Description: A cloning plasmid for the ZBTB6 gene.

Anti-ZBTB6 (2E12)

YF-MA17479 100 ug
EUR 363
Description: Mouse monoclonal to ZBTB6


ELI-35218h 96 Tests
EUR 824


ELI-30644b 96 Tests
EUR 928

Mouse Zbtb6 ELISA KIT

ELI-40311m 96 Tests
EUR 865

Human ZBTB6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ZBTB6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ZBTB6 Recombinant Protein (Human)

RP035179 100 ug Ask for price

ZBTB6 Recombinant Protein (Rat)

RP237899 100 ug Ask for price

ZBTB6 Recombinant Protein (Mouse)

RP186281 100 ug Ask for price

Zbtb6 ORF Vector (Rat) (pORF)

ORF079301 1.0 ug DNA
EUR 506

ZBTB6 ORF Vector (Human) (pORF)

ORF011727 1.0 ug DNA
EUR 95

Zbtb6 ORF Vector (Mouse) (pORF)

ORF062095 1.0 ug DNA
EUR 506

ZBTB6 sgRNA CRISPR Lentivector set (Human)

K2660701 3 x 1.0 ug
EUR 339

Zbtb6 sgRNA CRISPR Lentivector set (Rat)

K6137901 3 x 1.0 ug
EUR 339

Zbtb6 sgRNA CRISPR Lentivector set (Mouse)

K4975901 3 x 1.0 ug
EUR 339

ZBTB6 sgRNA CRISPR Lentivector (Human) (Target 1)

K2660702 1.0 ug DNA
EUR 154

ZBTB6 sgRNA CRISPR Lentivector (Human) (Target 2)

K2660703 1.0 ug DNA
EUR 154

ZBTB6 sgRNA CRISPR Lentivector (Human) (Target 3)

K2660704 1.0 ug DNA
EUR 154

Zbtb6 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6137902 1.0 ug DNA
EUR 154

Zbtb6 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6137903 1.0 ug DNA
EUR 154

Zbtb6 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6137904 1.0 ug DNA
EUR 154

Zbtb6 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4975902 1.0 ug DNA
EUR 154

Zbtb6 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4975903 1.0 ug DNA
EUR 154

Zbtb6 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4975904 1.0 ug DNA
EUR 154

ZBTB6 Protein Vector (Human) (pPB-C-His)

PV046905 500 ng
EUR 329

ZBTB6 Protein Vector (Human) (pPB-N-His)

PV046906 500 ng
EUR 329

ZBTB6 Protein Vector (Human) (pPM-C-HA)

PV046907 500 ng
EUR 329

ZBTB6 Protein Vector (Human) (pPM-C-His)

PV046908 500 ng
EUR 329

ZBTB6 Protein Vector (Rat) (pPB-C-His)

PV317202 500 ng
EUR 603

ZBTB6 Protein Vector (Rat) (pPB-N-His)

PV317203 500 ng
EUR 603

ZBTB6 Protein Vector (Rat) (pPM-C-HA)

PV317204 500 ng
EUR 603

ZBTB6 Protein Vector (Rat) (pPM-C-His)

PV317205 500 ng
EUR 603

ZBTB6 Protein Vector (Mouse) (pPB-C-His)

PV248378 500 ng
EUR 603

ZBTB6 Protein Vector (Mouse) (pPB-N-His)

PV248379 500 ng
EUR 603

ZBTB6 Protein Vector (Mouse) (pPM-C-HA)

PV248380 500 ng
EUR 603

ZBTB6 Protein Vector (Mouse) (pPM-C-His)

PV248381 500 ng
EUR 603

Zbtb6 3'UTR GFP Stable Cell Line

TU172494 1.0 ml Ask for price

ZBTB6 3'UTR GFP Stable Cell Line

TU078713 1.0 ml
EUR 1521

Zbtb6 3'UTR Luciferase Stable Cell Line

TU122494 1.0 ml Ask for price

ZBTB6 3'UTR Luciferase Stable Cell Line

TU028713 1.0 ml
EUR 1521

Zbtb6 3'UTR Luciferase Stable Cell Line

TU223571 1.0 ml Ask for price

Zbtb6 3'UTR GFP Stable Cell Line

TU273571 1.0 ml Ask for price

Zinc Finger And BTB Domain-Containing Protein 6 (ZBTB6) Antibody

abx038071-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Zinc Finger And BTB Domain-Containing Protein 6 (ZBTB6) Antibody

abx029744-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Zinc Finger And BTB Domain-Containing Protein 6 (ZBTB6) Antibody

abx029744-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Zinc Finger And BTB Domain-Containing Protein 6 (ZBTB6) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

ZBTB6 Rabbit Polyclonal Antibody