An embedded gene choice methodology utilizing knockoffs optimizing neural community
Background: Gene alternative refers to find a small subset of discriminant genes from the gene expression profiles. The best way to decide on genes that affect explicit phenotypic traits efficiently is an important evaluation work throughout the topic of biology. The neural neighborhood has increased changing into functionality when dealing with nonlinear data, and it’ll most likely seize choices robotically and flexibly. On this work, we propose an embedded gene alternative methodology using neural neighborhood.
The important genes could also be obtained by calculating the burden coefficient after the teaching is achieved. In an effort to treatment the problem of black subject of neural neighborhood and extra make the teaching outcomes interpretable in neural neighborhood, we use the idea of knockoffs to assemble the knockoff attribute genes of the distinctive attribute genes. This technique not solely make each attribute gene to compete with each other, however moreover make each attribute gene compete with its knockoff attribute gene. This methodology could assist to select the necessary factor genes that affect the decision-making of neural networks.
Outcomes: We use maize carotenoids, tocopherol methyltransferase, raffinose family oligosaccharides and human breast most cancers dataset to do verification and analysis.
Conclusions: The experiment outcomes show that the knockoffs optimizing neural neighborhood methodology has increased detection affect than the alternative current algorithms, and particularly for processing the nonlinear gene expression and phenotype data.

Fenretinide |
A3412-10 |
ApexBio |
10 mg |
EUR 108 |
Description: Fenretinide(4HPR) is an inhibitor of Focal adhesion kinase (FAK) [1].Fenretinideis a vitamin A analogue, it has been shown toinhibit the growth of many tumor cells, including small-cell lung cancer, malignant hemopoietic cells, and breast cancer cells. |
Fenretinide |
A3412-5.1 |
ApexBio |
10 mM (in 1mL DMSO) |
EUR 113 |
Description: Fenretinide(4HPR) is an inhibitor of Focal adhesion kinase (FAK) [1].Fenretinideis a vitamin A analogue, it has been shown toinhibit the growth of many tumor cells, including small-cell lung cancer, malignant hemopoietic cells, and breast cancer cells. |
Fenretinide |
A3412-50 |
ApexBio |
50 mg |
EUR 152 |
Description: Fenretinide(4HPR) is an inhibitor of Focal adhesion kinase (FAK) [1].Fenretinideis a vitamin A analogue, it has been shown toinhibit the growth of many tumor cells, including small-cell lung cancer, malignant hemopoietic cells, and breast cancer cells. |
Single cell transcriptomes reveal expression patterns of chemoreceptor genes in olfactory sensory neurons of the Caribbean spiny lobster, Panulirus argus
Background: Crustaceans categorical quite a lot of programs of receptor genes of their antennules, which house olfactory sensory neurons (OSNs) and non-olfactory chemosensory neurons. Transcriptomics analysis reveal that candidate chemoreceptor proteins embrace variant Ionotropic Receptors (IRs) along with every co-receptor IRs and tuning IRs, Transient Receptor Potential (TRP) channels, Gustatory Receptors, epithelial sodium channels, and class A G-protein coupled receptors (GPCRs). The Caribbean spiny lobster, Panulirus argus, expresses in its antennules nearly 600 IRs, 17 TRP channels, 1 Gustatory Receptor, 7 epithelial sodium channels, 81 GPCRs, 6 G proteins, and dozens of enzymes in signaling pathways.
However, the exact combinatorial expression patterns of these proteins in single sensory neurons normally aren’t acknowledged for any crustacean, limiting our understanding of how their chemosensory strategies encode chemical prime quality.
Outcomes: The aim of this analysis was to utilize transcriptomics to elucidate expression patterns of chemorece
Recombinant Sterol Carrier Protein 2 (SCP2) |
4-RPC835Ra01 |
Cloud-Clone |
-
EUR 433.31
-
EUR 219.00
-
EUR 1349.92
-
EUR 516.64
-
EUR 933.28
-
EUR 353.00
-
EUR 3224.80
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P11915
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 16.2kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Rat Sterol Carrier Protein 2 expressed in: E.coli |
Sterol Carrier Protein 2 (SCP2) Antibody |
20-abx006772 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Sterol Carrier Protein 2 (SCP2) Antibody |
abx026860-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Sterol Carrier Protein 2 (SCP2) Antibody |
abx026860-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Sterol Carrier Protein 2 (SCP2) Antibody |
abx038200-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Sterol Carrier Protein 2 (SCP2) Antibody |
20-abx131373 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Sterol Carrier Protein 2 (SCP2) Antibody |
20-abx131374 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Sterol Carrier Protein 2 (SCP2) Antibody |
20-abx141739 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Sterol Carrier Protein 2 (SCP2) Antibody |
abx034040-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Sterol Carrier Protein 2 (SCP2) Antibody |
abx034040-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Sterol Carrier Protein 2 (SCP2) Antibody |
abx237652-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Sterol Carrier Protein 2 (SCP2) Antibody |
abx237653-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Sterol Carrier Protein 2 (SCP2) Antibody |
abx237654-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Sterol Carrier Protein 2 (SCP2) Antibody |
20-abx320284 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Sterol Carrier Protein 2 (SCP2) Antibody |
20-abx322258 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human Sterol Carrier Protein 2 (SCP2) Protein |
20-abx650203 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1692.00
-
EUR 676.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Rat Sterol Carrier Protein 2 (SCP2) Protein |
20-abx650204 |
Abbexa |
-
EUR 606.00
-
EUR 258.00
-
EUR 1831.00
-
EUR 718.00
-
EUR 439.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Sterol Carrier Protein 2 (SCP2) ELISA Kit |
abx383064-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human) |
4-PAC835Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SCP2 (Ala433~Leu547)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2) |
Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat) |
4-PAC835Ra01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SCP2 (Ala433~Leu547)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2) |
Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human), APC |
4-PAC835Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SCP2 (Ala433~Leu547)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2). This antibody is labeled with APC. |
Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human), Biotinylated |
4-PAC835Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SCP2 (Ala433~Leu547)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2). This antibody is labeled with Biotin. |
Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human), Cy3 |
4-PAC835Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SCP2 (Ala433~Leu547)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2). This antibody is labeled with Cy3. |
Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human), FITC |
4-PAC835Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SCP2 (Ala433~Leu547)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2). This antibody is labeled with FITC. |
Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human), HRP |
4-PAC835Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SCP2 (Ala433~Leu547)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2). This antibody is labeled with HRP. |
Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human), PE |
4-PAC835Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SCP2 (Ala433~Leu547)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2). This antibody is labeled with PE. |
Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat), APC |
4-PAC835Ra01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SCP2 (Ala433~Leu547)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2). This antibody is labeled with APC. |
Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat), Biotinylated |
4-PAC835Ra01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SCP2 (Ala433~Leu547)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2). This antibody is labeled with Biotin. |
Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat), Cy3 |
4-PAC835Ra01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SCP2 (Ala433~Leu547)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2). This antibody is labeled with Cy3. |
Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat), FITC |
4-PAC835Ra01-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SCP2 (Ala433~Leu547)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2). This antibody is labeled with FITC. |
Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat), HRP |
4-PAC835Ra01-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SCP2 (Ala433~Leu547)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2). This antibody is labeled with HRP. |
Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat), PE |
4-PAC835Ra01-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SCP2 (Ala433~Leu547)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2). This antibody is labeled with PE. |
Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human), APC-Cy7 |
4-PAC835Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SCP2 (Ala433~Leu547)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2). This antibody is labeled with APC-Cy7. |
Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAC835Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: SCP2 (Ala433~Leu547)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2). This antibody is labeled with APC-Cy7. |
Sterol Carrier Protein 2 Antibody |
20-abx115858 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Sterol carrier protein 2 Antibody |
abx431575-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
SCP2 sterol-binding domain containing 1 Protein |
20-abx263414 |
Abbexa |
-
EUR 1609.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Rabbit Sterol carrier protein 2 ELISA kit |
E04S0001-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Sterol carrier protein 2 ELISA kit |
E04S0001-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Sterol carrier protein 2 ELISA kit |
E04S0001-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Sterol carrier protein 2 ELISA kit |
E02S0001-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Sterol carrier protein 2 ELISA kit |
E02S0001-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Sterol carrier protein 2 ELISA kit |
E02S0001-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Sterol carrier protein 2 ELISA kit |
E03S0001-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Sterol carrier protein 2 ELISA kit |
E03S0001-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Sterol carrier protein 2 ELISA kit |
E03S0001-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Sterol carrier protein 2 ELISA kit |
E01S0001-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Sterol carrier protein 2 ELISA kit |
E01S0001-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Sterol carrier protein 2 ELISA kit |
E01S0001-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Sterol carrier protein 2 ELISA kit |
E06S0001-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Sterol carrier protein 2 ELISA kit |
E06S0001-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Sterol carrier protein 2 ELISA kit |
E06S0001-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Sterol carrier protein 2 ELISA kit |
E08S0001-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Sterol carrier protein 2 ELISA kit |
E08S0001-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Sterol carrier protein 2 ELISA kit |
E08S0001-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Sterol carrier protein 2 ELISA kit |
E07S0001-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Sterol carrier protein 2 ELISA kit |
E07S0001-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Sterol carrier protein 2 ELISA kit |
E07S0001-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Sterol carrier protein 2 ELISA kit |
E09S0001-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Sterol carrier protein 2 ELISA kit |
E09S0001-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Sterol carrier protein 2 ELISA kit |
E09S0001-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
SCP2D1 SCP2 sterol-binding domain containing 1 Human Recombinant Protein |
PROTQ9UJQ7 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: SCP2D1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 179 amino acids (1-156 a.a) and having a molecular mass of 20.1kDa.SCP2D1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
Polyclonal Sterol carrier protein 2 Antibody (internal region) |
APR10298G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Sterol carrier protein 2 (internal region). This antibody is tested and proven to work in the following applications: |
Guinea pig Sterol carrier protein 2 ELISA kit |
E05S0001-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Sterol carrier protein 2 ELISA kit |
E05S0001-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Sterol carrier protein 2 ELISA kit |
E05S0001-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
SCP2 Recombinant Protein (Human) |
RP027781 |
ABM |
100 ug |
Ask for price |
SCP2 Recombinant Protein (Human) |
RP027784 |
ABM |
100 ug |
Ask for price |
SCP2 Recombinant Protein (Rat) |
RP227723 |
ABM |
100 ug |
Ask for price |
SCP2 Recombinant Protein (Mouse) |
RP170345 |
ABM |
100 ug |
Ask for price |
Recombinant purified (>98%) Human FAS Ligand Protein (carrier free) |
FASL15-R-2 |
Alpha Diagnostics |
2 ug |
EUR 347 |
SCP2 antibody |
70R-3015 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal SCP2 antibody raised against the middle region of SCP2 |
SCP2 Antibody |
39403-100ul |
SAB |
100ul |
EUR 390 |
SCP2 Antibody |
43535-100ul |
SAB |
100ul |
EUR 252 |
SCP2 Antibody |
1-CSB-PA020856DA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SCP2. Recognizes SCP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
SCP2 Antibody |
1-CSB-PA020856ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against SCP2. Recognizes SCP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
SCP2 Antibody |
1-CSB-PA020856ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against SCP2. Recognizes SCP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200 |
SCP2 Antibody |
1-CSB-PA020856GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against SCP2. Recognizes SCP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
SCP2 siRNA |
20-abx904812 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SCP2 siRNA |
20-abx932653 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SCP2 siRNA |
20-abx932654 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-SCP2 |
YF-PA14533 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to SCP2 |
anti-SCP2 |
YF-PA14534 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to SCP2 |
Recombinant Human TFF-2 Protein |
PROTQ03403-2 |
BosterBio |
20ug |
EUR 317 |
Description: The Trefoil Factor peptides (TFF1, TFF2 and TFF3) are expressed in the gastrointestinal tract, and appear to play an important role in intestinal mucosal defense and repair. TFF2 has been shown to inhibit gastrointestinal motility and gastric acid secretion. Recent data suggests a potential role for TFF2 in acute and chronic asthma (Nikolaidis, N.M. et al. Am. Journal Respir. Cell Mol. Biol. (2003) 4: 458-464). Recombinant human TFF2 is a 12.0 kDa polypeptide of 107 amino acid residues, which includes a 40-amino acid trefoil motif containing three conserved intramolecular disulfide bonds. |
Recombinant Human BD-2 Protein |
PROTO15263-2 |
BosterBio |
20ug |
EUR 317 |
Description: Defensins (alpha and beta) are cationic peptides with a broad spectrum of antimicrobial activity that comprise an important arm of the innate immune system. The α-defensins are distinguished from the β-defensins by the pairing of their three disulfide bonds. To date, six human β-defensins have been identified; BD-1, BD-2, BD-3, BD-4, BD-5 and BD-6. β-defensins are expressed on some leukocytes and at epithelial surfaces. In addition to their direct antimicrobial activities, they can act as chemoattractants towards immature dendritic cells and memory T cells. The β-defensin proteins are expressed as the C-terminal portion of precursors and are released by proteolytic cleavage of a signal sequence and in some cases, a propeptide sequence. β-defensins contain a six-cysteine motif that forms three intra-molecular disulfide bonds. Recombinant human BD-2 is a 4.3 kDa protein containing 41 amino acid residues. |
Recombinant Human Relaxin-2 Protein |
PROTP04090-2 |
BosterBio |
25ug |
EUR 317 |
Description: Relaxin-2 is a peptide hormone structurally related to insulin, which is expressed in the placenta, decidua, prostate, and in the ovary during pregnancy. Of the three known relaxin genes, Relaxin-2 is the only relaxin known to circulate in the blood. Relaxin-2 binds specifically to the LGR7 and LGR8 receptors, previously identified as an “orphan” G protein coupled receptors. Signaling by Relaxin-2 through its target receptors enhances the growth of pubic ligaments and ripening of the cervix during birth. Recombinant Relaxin-2 is a nonglycosylated 6.0 kDa disulfide linked heterodimeric protein consisting of a 24 amino acid A-chain and a 29 amino acid B-chain. |
Recombinant Murine IL-2 Protein |
PROTP04351-2 |
BosterBio |
20ug |
EUR 317 |
Description: IL-2 is a powerful immunoregulatory lymphokine produced by T-cells in response to antigenic or mitogenic stimulation. IL-2/IL-2R signaling is required for T-cell proliferation and other fundamental functions which are essential for the immune response. IL-2 stimulates growth and differentiation of B-cells, NK cells, lymphokine activated killer cells, monocytes, macrophages and oligodendrocytes. Recombinant murine IL-2 is a 17.2 kDa protein, containing 149 amino acid residues. |
Recombinant Human PAI-2 Protein |
PROTP05120-2 |
BosterBio |
10ug |
EUR 317 |
Description: PAI-2 is an inhibitory serpin expressed mainly in keratinocytes, activated monocytes, and placental trophoblasts. It exists predominantly as a 47 kDa nonglycosylated intracellular protein which can be induced to be secreted as 60 kDa glycoprotein. The glycosylated and unglycosylated forms of PAI-2 are equally effective as inhibitors of urokinase-type plasminogen activator (uPA), the only established physiological target of this serpin. PAI-2 has a unique ability to form dormant polymers spontaneously and reversibly under physiological conditions. The physiological relevance of this property, which is neither a consequence of any mutation in the PAI-2 gene nor associated with any known disorder, is still unclear. However, it appears that the formation of intracellular dormant polymers may be important for the controlled release of the inhibitor from PAI-2 producing cells. Plasma levels of PAI-2 are usually low or undetectable, except during pregnancy and in some forms of monocytic leukemia. Secretion of PAI-2 from the placenta normally occurs during the third trimester of pregnancy and accounts for the dramatic increase in PAI-2 levels (up to 250 ng/ml), which are maintained at these levels until postpartum, and then rapidly decline. In addition to its vital role in protecting the placenta from degradation by uPA and/or uPA-activated proteases, PAI-2 has been shown to be essential for the prevention of metastatic spread of neck, lung and breast cancers. The beneficial effect of PAI-2 seen in these studies is presumed to stem from its ability to inhibit uPA-dependent cell dissemination. PAI-2 has also been reported to inhibit keratinocyte proliferation, and to participate in the innate immune response during viral infection. Recombinant human PAI-2 is a 415-residue nonglycosylated protein. |
Recombinant Human MMP-2 Protein |
PROTP08253-2 |
BosterBio |
10ug |
EUR 317 |
Description: Matrix metalloproteinases (MMPs) are a family of endoproteases that require zinc and calcium for expressing catalytic activity. These enzymes play a central role in the maintenance and remodeling of the extracellular matrix. Elevated expression of their activity, caused either by up-regulation of their expression or down-regulation of their cognate inhibitors, has been implicated in various degenerative disorders, including arthritis, cardiovascular disease, skeletal growth-plate disorders, and cancer metastasis. MMP-2 is a secreted collagenase with specificity toward Type IV, V, VII, and X collagens. Recombinant human MMP-2 is a 62.0 kDa protein containing the entire catalytic N-terminal domain and the C-terminal domain (552 amino acids). |
Mouse FGF-2 Recombinant Protein |
R00121-2 |
BosterBio |
5ug/vial |
EUR 259 |
Description: FGF basic (FGF2) is a multipotential fibroblast growth factor that stimulates and supports proliferation, migration and differentiation. Mouse FGF basic (FGF-2) Recombinant Protein is purified FGF basic (FGF-2) produced in yeast. |
Chicken IL-2 Recombinant Protein |
R00387-2 |
BosterBio |
5ug/vial |
EUR 259 |
Description: Interleukin-2 (IL-2) is a cytokine produced by T-helper cells in response to antigenic or mitogenic stimulation. It is required for T-cell proliferation and other activities crucial to the regulation of the immune response. Chicken IL-2 Recombinant Protein is purified interleukin-2 produced in yeast. |
BMP-2 Bone Morphogenetic Protein-2 Human Recombinant Protein, Monomer |
PROTP12643-2 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: Bone Morphogenetic Protein-2 Human Recombinant produced in E.Coli is a monomeric, non-glycosylated, Polypeptide chain containing 115 amino acids (283-396) and having a molecular mass of 13009 Dalton. ;The BMP-2 is purified by proprietary chromatographic techniques. |
ErbB2 ErbB-2 Human Recombinant Protein |
PROTP04626-2 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: ErbB-2 Human Recombinant is a 43.4 kDa protein containing 397 amino acid residues of the human Herstatin, and an extra Methionine at N-Terminal (underlined), produced in E.coli. |
IL-2 Interleukin-2 Human Recombinant Protein, His Tag |
PROTP60568-2 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: Interleukin-2 Human Recombinant produced in E.Coli is a single, non-glycosylated, Polypeptide chain containing 133 amino acids fragment (21-153) having a molecular weight of 20kDa and fused with a 4.5kDa amino-terminal hexahistidine tag. _x000D_ The IL-2 His is purified by proprietary chromatographic techniques._x000D_ |
Anti-SCP2 Antibody |
A1414-100 |
Biovision |
|
EUR 370 |
SCP2 Blocking Peptide |
33R-6715 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SCP2 antibody, catalog no. 70R-3015 |
SCP2 Conjugated Antibody |
C43535 |
SAB |
100ul |
EUR 397 |
SCP2 cloning plasmid |
CSB-CL020856HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 432
- Sequence: atgggttttccggaagccgccagttcttttagaactcatcaaattgaagctgttccaaccagctctgcaagtgatggatttaaggcaaatcttgtttttaaggagattgagaagaaacttgaagaggaaggggaacagtttgtgaagaaaatcggtggtatttttgccttcaaggt
- Show more
|
Description: A cloning plasmid for the SCP2 gene. |
SCP2 cloning plasmid |
CSB-CL020856HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 969
- Sequence: atgtcctcttccccgtgggagcctgcgaccctgcgccgggtgttcgtggtgggggttggcatgaccaagtttgtgaagcctggagctgagaattcaagagactaccctgacttggcagaagaagcaggcaagaaggctttagctgatgcacagatcccttattcagcagtggacca
- Show more
|
Description: A cloning plasmid for the SCP2 gene. |
SCP2 Rabbit pAb |
A5382-100ul |
Abclonal |
100 ul |
EUR 308 |
SCP2 Rabbit pAb |
A5382-200ul |
Abclonal |
200 ul |
EUR 459 |
SCP2 Rabbit pAb |
A5382-20ul |
Abclonal |
20 ul |
EUR 183 |
SCP2 Rabbit pAb |
A5382-50ul |
Abclonal |
50 ul |
EUR 223 |
SCP2 Polyclonal Antibody |
A54392 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
anti- SCP2 antibody |
FNab07652 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: sterol carrier protein 2
- Uniprot ID: P22307
- Gene ID: 6342
- Research Area: Metabolism
|
Description: Antibody raised against SCP2 |
anti- SCP2 antibody |
FNab07653 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: sterol carrier protein 2
- Uniprot ID: P22307
- Gene ID: 6342
- Research Area: Metabolism
|
Description: Antibody raised against SCP2 |
anti- SCP2 antibody |
FNab07654 |
FN Test |
100µg |
EUR 585 |
- Immunogen: sterol carrier protein 2
- Uniprot ID: P22307
- Gene ID: 6342
- Research Area: Metabolism
|
Description: Antibody raised against SCP2 |
Anti-SCP2 antibody |
STJ27335 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes two proteins: sterol carrier protein X (SCPx) and sterol carrier protein 2 (SCP2), as a result of transcription initiation from 2 independently regulated promoters. The transcript initiated from the proximal promoter encodes the longer SCPx protein, and the transcript initiated from the distal promoter encodes the shorter SCP2 protein, with the 2 proteins sharing a common C-terminus. Evidence suggests that the SCPx protein is a peroxisome-associated thiolase that is involved in the oxidation of branched chain fatty acids, while the SCP2 protein is thought to be an intracellular lipid transfer protein. This gene is highly expressed in organs involved in lipid metabolism, and may play a role in Zellweger syndrome, in which cells are deficient in peroxisomes and have impaired bile acid synthesis. Alternative splicing of this gene produces multiple transcript variants, some encoding different isoforms. |
Recombinant Human TGF-Beta 2 (insect derived) Protein |
PROTP61812-2 |
BosterBio |
10ug |
EUR 317 |
Description: The three mammalian isoforms of TGF-β, TGF-β1, β2, β3, signal through the same receptor and elicit similar biological responses. They are multifunctional cytokines that regulate cell proliferation, growth, differentiation and motility as well as synthesis and deposition of the extracellular matrix. They are involved in various physiological processes including embryogenesis, tissue remodeling and wound healing. They are secreted predominantly as latent complexes which are stored at the cell surface and in the extracellular matrix. The release of biologically active TGF-β isoform from a latent complex involves proteolytic processing of the complex and /or induction of conformational changes by proteins such as thrombospondin-1. TGF-β2 has been shown to exert suppressive effects on IL-2 dependent T-cell growth, and may also have an autocrine function in enhancing tumor growth by suppressing immuno-surveillance of tumor development. Recombinant human TGF-β2 is a 25.0 kDa protein composed of two identical 112 amino acid polypeptide chains linked by a single disulfide bond. * Manufactured using (BTI-Tn-5B1-4) cells under license from the Boyce Thompson Institute for Plant Research, Inc. |
Scp2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4797203 |
ABM |
1.0 ug DNA |
EUR 154 |
Scp2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6784603 |
ABM |
1.0 ug DNA |
EUR 154 |
SCP2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2104303 |
ABM |
1.0 ug DNA |
EUR 154 |
AHSG Alpha-2-HS-Glycoprotein Human Recombinant Protein HEK |
PROTP02765-2 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: AHSG Human Recombinant produced by transfected human cells is a single polypeptide chain containing 357 amino acids (19-367). AHSG is fused to an 8 amino acid His-tag at C-terminus & purified by proprietary chromatographic techniques. |
FGF-2 Fibroblast Growth Factor-Basic Human Recombinant Protein |
PROTP09038-2 |
BosterBio |
Regular: 50ug |
EUR 317 |
Description: Fibroblast Growth Factor-2 Human Recombinant (FGF-2) produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 154 amino acids and having a molecular mass of 17.2kDa.;The FGF-b is purified by proprietary chromatographic techniques. |
TIMP2 Tissue Inhibitor of Metalloprotease 2 Human Recombinant Protein |
PROTP16035-2 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: TIMP2 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 194 amino acids and having a molecular mass of 21.8kDa.  |
Sterol O-Acyltransferase 2 (SOAT2) Antibody |
abx238098-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Sterol O-Acyltransferase 2 (SOAT2) Antibody |
20-abx321144 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Sterol O-Acyltransferase 2 (SOAT2) Antibody |
20-abx321997 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Sterol Regulatory Element-Binding Protein 2 (SREBF2) Antibody |
abx025838-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Sterol Regulatory Element-Binding Protein 2 (SREBF2) Antibody |
abx025838-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Sterol Regulatory Element-Binding Protein 2 (SREBF2) Antibody |
20-abx005230 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Sterol Regulatory Element-Binding Protein 2 (SREBF2) Antibody |
20-abx003038 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Sterol Regulatory Element-Binding Protein 2 (SREBP2) Antibody |
20-abx218757 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Sterol Regulatory Element-Binding Protein 2 (SREBF2) Antibody |
20-abx115859 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Sterol Regulatory Element-Binding Protein 2 (SREBF2) Antibody |
abx238221-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Sterol regulatory element-binding protein 2 (SREBF2) Antibody |
20-abx241423 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Sterol regulatory element-binding protein 2 (SREBF2) Antibody |
20-abx242399 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Sterol regulatory element-binding protein 2 (SREBF2) Antibody |
20-abx334108 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
PLGF2 Human, Placenta Growth Factor-2 Human Recombinant Protein, CHO |
PROTP49763-2 |
BosterBio |
Regular: 25ug |
EUR 317 |
Description: PLGF2 Human Recombinant (19-170 a.a.) produced in CHO is a disulfide-linked homodimeric, glycosylated, polypeptide chain containing 152 amino acids and having a molecular mass of 33kDa.;The PLGF-2 Human Recombinant protein is purified by proprietary chromatographic techniques. |
B2M Human, Beta 2 Microglobulin Human Recombinant Protein, His Tag |
PROTP61769-2 |
BosterBio |
Regular: 5ug |
EUR 317 |
Description: B2M Recombinant Human produced in E.Coli is a single, non-glycosylated polypeptide chain containing 120 amino acids (1-119 a.a.) and having a molecular mass of 14 kDa. The B2M is fused to a 21 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques. |
LCN2 Neutrophil Gelatinase Associated Lipocalin/Lipocalin-2 Human Recombinant Protein |
PROTP80188-2 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: LCN2 Human Recombinant produced in E.Coli is a homodimeric non-glycosylated polypeptide chains consisting of two 178 amino acids and having a molecular mass of 41.0kDa.  |
TNFR2 Tumor Necrosis Factor Receptor Type 2 Human Recombinant Protein |
PROTP20333-2 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: TNFR2 Human produced in E.Coli is a single, non-glycosylated polypeptide chain containing 184 amino acids and having a molecular mass of 20kDa. The TNFR2 is purified by proprietary chromatographic techniques. |
Recombinant human Sterol regulatory element-binding protein 2 (SREBP2) protein control for WB |
SREBP23-C |
Alpha Diagnostics |
100 ul |
EUR 286 |
Mouse SCP2 shRNA Plasmid |
20-abx972590 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat SCP2 shRNA Plasmid |
20-abx985105 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SCP2 Antibody, HRP conjugated |
1-CSB-PA020856DB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SCP2. Recognizes SCP2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
SCP2 Antibody, FITC conjugated |
1-CSB-PA020856DC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SCP2. Recognizes SCP2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
SCP2 Antibody, Biotin conjugated |
1-CSB-PA020856DD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SCP2. Recognizes SCP2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Human SCP2 shRNA Plasmid |
20-abx954277 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Anti-SCP2 (2E9-1B3) |
YF-MA15348 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to SCP2 |
DCTN2 (1-403) Dynactin 2 (1-403 a.a.) Human Recombinant Protein |
PROTQ13561-2 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: Dynactin 2 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 426 amino acids (1-403 a.a) and having a molecular mass of 46.9kDa.;DCTN2 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
RARRES2 Human, Retinoic Acid Receptor Responder 2 Human Recombinant Protein,Sf9 |
PROTQ99969-2 |
BosterBio |
Regular: 5ug |
EUR 317 |
Description: RARRES2 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 146 amino acids (21-157a.a.) and having a molecular mass of 16.9kDa. (Molecular size on SDS-PAGE will appear at approximately 18-28kDa). RARRES2 is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques. |
Viral Nucleic Acid Extraction Kit I (300prep),
(With Carrier RNA, for low viral load specimen using carrier RNA) |
FAVNK-001-2 |
Favorgen |
300 preps |
EUR 397 |
Streptavidin Recombinant Protein |
PROTP22629-2 |
BosterBio |
Regular: 20mg |
EUR 317 |
Description: Streptavidin Streptomyces Avidinii Recombinant produced in E.Coli. ;The molecular weight per tetramer is approximately 52kDa. |
Sterol regulatory element-binding protein 2 (SREBF2) Antibody (HRP) |
20-abx337817 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Sterol regulatory element-binding protein 2 (SREBF2) Antibody (FITC) |
20-abx337818 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Sterol regulatory element-binding protein 2 (SREBF2) Antibody (Biotin) |
20-abx337819 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Recombinant Acyl Carrier Protein, Mitochondrial (ACP) |
4-RPA361Hu01 |
Cloud-Clone |
-
EUR 512.16
-
EUR 240.00
-
EUR 1645.60
-
EUR 615.20
-
EUR 1130.40
-
EUR 406.00
-
EUR 3964.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O14561
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 17.7kDa
- Isoelectric Point: 6.7
|
Description: Recombinant Human Acyl Carrier Protein, Mitochondrial expressed in: E.coli |
Recombinant Acyl Carrier Protein, Mitochondrial (ACP) |
4-RPA361Mu01 |
Cloud-Clone |
-
EUR 526.50
-
EUR 244.00
-
EUR 1699.36
-
EUR 633.12
-
EUR 1166.24
-
EUR 415.00
-
EUR 4098.40
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9CR21
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 17.9kDa
- Isoelectric Point: 7.8
|
Description: Recombinant Mouse Acyl Carrier Protein, Mitochondrial expressed in: E.coli |
Recombinant Oxoglutarate Carrier Protein, Mitochondrial (OGC) |
4-RPE461Hu01 |
Cloud-Clone |
-
EUR 413.60
-
EUR 214.00
-
EUR 1276.00
-
EUR 492.00
-
EUR 884.00
-
EUR 340.00
-
EUR 3040.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q02978
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 37.8kDa
- Isoelectric Point: 9.9
|
Description: Recombinant Human Oxoglutarate Carrier Protein, Mitochondrial expressed in: E.coli |
a.a.), TRAIL/APO 2 Ligand (114-281 a.a.) Human Recombinant Protein, Active |
PROTP50591-2 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: Soluble TNF-related apoptosis-inducing ligand Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 169 amino acids _x000D_ (114-281) and having a molecular mass of 19.6 kDa._x000D_ The sTRAIL is purified by proprietary chromatographic techniques. |
SLC3A2 Solute Carrier Family 3 Member 2 Human Recombinant Protein |
PROTP08195 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: SLC3A2 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 434 amino acids (206-630a.a.) and having a molecular mass of 47.9kDa. (Molecular size on SDS-PAGE will appear at approximately 40-57kDa).;SLC3A2 is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques. |
Recombinant Human Sterol O-Acyltransferase 2/SOAT2/ACAT2 (N-Trx, 6His) |
CG82-10ug |
Novoprotein |
10ug |
EUR 202 |
Description: Supplied as a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4. |
Recombinant Human Sterol O-Acyltransferase 2/SOAT2/ACAT2 (N-Trx, 6His) |
CG82-1mg |
Novoprotein |
1mg |
EUR 2486 |
Description: Supplied as a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4. |
Recombinant Human Sterol O-Acyltransferase 2/SOAT2/ACAT2 (N-Trx, 6His) |
CG82-500ug |
Novoprotein |
500ug |
EUR 1755 |
Description: Supplied as a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4. |
Recombinant Human Sterol O-Acyltransferase 2/SOAT2/ACAT2 (N-Trx, 6His) |
CG82-50ug |
Novoprotein |
50ug |
EUR 496 |
Description: Supplied as a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4. |
Recombinant Human NOV Protein |
PROTP48745-2 |
BosterBio |
20ug |
EUR 317 |
Description: NOV is a member of the CCN family of secreted cysteine rich regulatory proteins. The full length NOV protein contains four structural domains that confer distinct, and sometimes opposing, biological activities. Elevated expression of NOV is associated with certain tumors, including Wilm’s tumor and most nephroblastomas. However, in other tumor types and certain cancer cell lines, increased tumorgenicity and proliferation is correlated with decreased NOV expression. Additionally, NOV induces cell adhesion and cell migration by signaling through specific cell surface integrins and by binding to heparin sulfate proteoglycans and to fibulin 1C. NOV has also been reported to exert proangiogenic activities. Recombinant human NOV is a 36.2 kDa protein containing 331 amino acid residues. It is composed of four distinct structural domains (modules); the IGF binding protein (IGFBP) domain, the von Willebrand Factor C (VWFC) domain, the Thrombospondin type-I (TSP type-1) domain, and a C-terminal cysteine knot-like domain (CTCK). |
Recombinant Rat Leptin Protein |
PROTP50596-2 |
BosterBio |
1mg |
EUR 317 |
Description: Encoded by the ob (obese) gene, Leptin is an adipose-derived cytokine that suppresses appetite and increases thermogenesis. Leptin exerts its anorectic effect via signaling through a hypothalamic receptor termed OB-R. Leptin has been shown to reduce body weight, food consumption, and plasma glucose levels in various in vivo models. Recombinant Rat Leptin is a 16.2 kDa protein containing 147 amino acid residues. |
Recombinant Human MANF Protein |
PROTP55145-2 |
BosterBio |
25ug |
EUR 317 |
Description: MANF is a secreted neurotrophic factor that is expressed in brain, neuronal and certain non-neuronal tissues. It has been shown to promote survival, growth and function of dopamine specific neurons. MANF and its structural homolog CDNF, each contain an N-terminal saposin-like lipid binding domain, and a carboxyl-terminal domain, which is not homologous to previously characterized protein structures. MANF and CDNF can prevent 6-OHDA induced degeneration of dopaminergic neurons by triggering survival pathways in a rat experimental model of Parkinson disease. Recombinant human MANF is an 18.1 kDa protein consisting of 158 amino acids including 8 cysteine residues. |
Recombinant Human Enterokinase Protein |
PROTP98073-2 |
BosterBio |
50ug |
EUR 317 |
Description: Proteases (also called Proteolytic Enzymes, Peptidases, or Proteinases) are enzymes that hydrolyze the amide bonds within proteins or peptides. Most proteases act in a specific manner, hydrolyzing bonds at or adjacent to specific residues or a specific sequence of residues contained within the substrate protein or peptide. Proteases play an important role in most diseases and biological processes including prenatal and postnatal development, reproduction, signal transduction, the immune response, various autoimmune and degenerative diseases, and cancer. They are also an important research tool, frequently used in the analysis and production of proteins. Enterokinase sequentially cleaves carboxyl side of D-D-D-D-K. Human Enterokinase is expressed as a linear 1019 amino acid polypeptide precursor glycoprotein. Proteolytic processing of this precursor generates the biologically active form of Enterokinase, which consists of two polypeptide chains (heavy chain and light chain) held together by a single disulfide bond, resulting in formation of a biologically active heterodimer. The heavy chain consists of 784 amino acid residues, and the light consists of 235 amino acid residues. |
Recombinant Human MIA Protein |
PROTQ16674-2 |
BosterBio |
20ug |
EUR 317 |
Description: MIA is the first discovered member of a family of secreted cytokines termed the MIA/OTOR family. The four known members of this family; MIA, MIA2, OTOR and TANGO each contain a Src homology-3 (SH3)-like domain. MIA is an autocrine growth regulatory protein secreted from chondrocytes and malignant melanoma cells that promotes melanoma metastasis by binding competitively to fibronectin and laminin in a manner that results in melanoma cell detachment from the extracellular matrix in vivo. Elevated levels of MIA may represent a clinically useful marker for diagnosis of melanoma metastasis as well as a potential marker for rheumatoid arthritis. Recombinant human MIA is a 12.2 kDa globular protein containing 108 amino acid residues including two intramolecular disulfide bonds. |
Recombinant Human TSLP Protein |
PROTQ969D9-2 |
BosterBio |
10ug |
EUR 317 |
Description: TSLP is a hemopoietic protein that is expressed in the heart, liver and prostate. TSLP overlaps biological activities with IL-7 and binds with the heterodimeric receptor complex consisting of the IL-7R α chain (IL-7Rα) and the TSLP-specific chain (TSLPR). Like IL-7, TSLP induces phosphorylation of STAT3 and STAT5, but uses kinases other than the JAKs for activation. TSLP prohibited apoptosis and stimulated growth of the human acute myeloid leukemia (AML)-derived cell line MUTZ3. It induces the release of T cell-attracting chemokines TARC and MDC from monocytes and activates CD11c(+) dendritic cells (DCs). TSLP activated DCs primed naïve T cells to produce the proallergic cytokines (IL-4, IL-5, IL-13, TNFα) while down-regulating IL-10 and IFN-γ suggesting a role in initiating allergic inflammation. Recombinant human TSLP is a 15.0 kDa protein consisting of 132 amino acid residues. |
Recombinant Human Neuroserpin Protein |
PROTQ99574-2 |
BosterBio |
25ug |
EUR 317 |
Description: Neuroserpin is an inhibitory serpin that is expressed predominantly in central nervous system. Although the physiological target of neuroserpin is still unclear, cumulative evidence suggest that it plays an important role in controlling proteolytic degradation of extracellular matrix (ECM) during synaptogenesis and the subsequent development of neuronal plasticity. In the adult brain, neuroserpin is secreted from the growth cones of neurons in areas where synaptic changes are associated with learning and memory, i.e. cerebral cortex, hippocampus, and amygdala. The neuroprotective role of neuroserpin has been demonstrated in transgenic mice lacking neuroserpin expression. The deficiency of neuroserpin in these mice was associated with motor neuron disease characterized by axonal degradation. In humans, defects in neuroserpin, caused by point mutations in the neuroserpin gene, underlie a hereditary disorder called the familial encephalopathy with neuroserpin inclusion bodies (FENIB). Recombinant human neuroserpin is a 44.8 kDa non-glycosylated protein containing 395 amino-acid residues. |
NANOG Human Recombinant Protein |
PROTQ9H9S0-2 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: NANOG Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 305 amino acids (1-305) and having a molecular mass of 34.6 kDa.;The NANOG is purified by proprietary chromatographic techniques. |
Recombinant Human Neuritin Protein |
PROTQ9NPD7-2 |
BosterBio |
20ug |
EUR 317 |
Description: Neuritin is a neurotrophic factor, which is expressed in response to induction of neuronal activity by NGF, BDNF, NT3, and other neural stimulators. It is expressed primarily in postmitotic-differentiating neurons of the developing nervous system and in neuronal structures related to synaptic plasticity in the adult nervous system. Neuritin acts as a molecular mediator of neurite outgrowth, neuronal survival, and synaptic maturation. Recombinant human Neuritin is a covalently disulfide-linked homodimer, consisting of two 9.72 kDa polypeptide monomers, each containing 88 amino acid residues. |
TIGAR Human Recombinant Protein |
PROTQ9NQ88-2 |
BosterBio |
Regular: 25ug |
EUR 317 |
Description: TIGAR Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 270 amino acids and having a molecular mass of 30.1kDa. The TIGAR is purified by proprietary chromatographic techniques. |
Recombinant Human OTOR Protein |
PROTQ9NRC9-2 |
BosterBio |
20ug |
EUR 317 |
Description: OTOR, also called Otoraplin and MIAL, is a secreted cytokine and a member of the MIA/OTOR family. Members of this family which also includes MIA, MIA2, and TANGO share a Src homology-3 (SH3)-like domain. OTOR is predominantly expressed in the cochlea of the inner-ear and to a lesser extent in fetal brain and in some cartilage tissues. OTOR appears to be involved in early chondrogenesis of the otic capsule, which is required for normal inner ear development and auditory function. Recombinant human OTOR is a 12.7 kDa globular protein containing 112 amino acid residues. |
Recombinant Human Epiregulin Protein |
PROTO14944-2 |
BosterBio |
25ug |
EUR 317 |
Description: Epiregulin is an EGF related growth factor that binds specifically to EGFR (ErbB1) and ErbB4, but not ErbB2 or ErbB3. It is expressed mainly in the placenta and peripheral blood leukocytes and in certain carcinomas of the bladder, lung, kidney and colon. Epiregulin stimulates the proliferation of keratinocytes, hepatocytes, fibroblasts and vascular smooth muscle cells. It also inhibits the growth of several tumor-derived epithelial cell lines. Human Epiregulin is initially synthesized as a glycosylated 19.0 kDa transmembrane precursor protein, which is processed by proteolytic cleavage to produce a 6.0 kDa mature secreted sequence. Recombinant human Epiregulin is a 5.6 kDa monomeric protein, containing 50 amino residues, which corresponds to the mature secreted Epiregulin sequence. |
Recombinant Human LIGHT Protein |
PROTO43557-2 |
BosterBio |
15ug |
EUR 317 |
Description: LIGHT belongs to the TNF family of ligands, and can signal through the herpes virus entry mediator type A receptor (HVEM, TNFRSF14), LTβR, or bind to a decoy receptor, DcR3. It is expressed in splenocytes, activated PBL, CD+8 tumor infiltrating lymphocytes, granulocytes, and monocytes. LIGHT has the ability to active NFκB, to co-stimulate the activation of lymphocytes and to induce apoptosis in certain human tumor cells. Recombinant human LIGHT has a calculated mass of 19.3 kDa containing 177 amino acid residues. Due to glycosylation LIGHT migrates between 20.0-22.5 kDa by SDS-PAGE under non-reducing conditions. *Human LIGHT(Catalog Number 310-09B) has replaced Human LIGHT(Catalog Number 310-09) |