A Key Sociocultural Method of Camelback Leisure Driving

An embedded gene choice methodology utilizing knockoffs optimizing neural community


Background: Gene alternative refers to find a small subset of discriminant genes from the gene expression profiles. The best way to decide on genes that affect explicit phenotypic traits efficiently is an important evaluation work throughout the topic of biology. The neural neighborhood has increased changing into functionality when dealing with nonlinear data, and it’ll most likely seize choices robotically and flexibly. On this work, we propose an embedded gene alternative methodology using neural neighborhood.


The important genes could also be obtained by calculating the burden coefficient after the teaching is achieved. In an effort to treatment the problem of black subject of neural neighborhood and extra make the teaching outcomes interpretable in neural neighborhood, we use the idea of knockoffs to assemble the knockoff attribute genes of the distinctive attribute genes. This technique not solely make each attribute gene to compete with each other, however moreover make each attribute gene compete with its knockoff attribute gene. This methodology could assist to select the necessary factor genes that affect the decision-making of neural networks.


Outcomes: We use maize carotenoids, tocopherol methyltransferase, raffinose family oligosaccharides and human breast most cancers dataset to do verification and analysis.


Conclusions: The experiment outcomes show that the knockoffs optimizing neural neighborhood methodology has increased detection affect than the alternative current algorithms, and particularly for processing the nonlinear gene expression and phenotype data.




EUR 185


EUR 588


A3412-10 10 mg
EUR 108
Description: Fenretinide(4HPR) is an inhibitor of Focal adhesion kinase (FAK) [1].Fenretinideis a vitamin A analogue, it has been shown toinhibit the growth of many tumor cells, including small-cell lung cancer, malignant hemopoietic cells, and breast cancer cells.


A3412-5.1 10 mM (in 1mL DMSO)
EUR 113
Description: Fenretinide(4HPR) is an inhibitor of Focal adhesion kinase (FAK) [1].Fenretinideis a vitamin A analogue, it has been shown toinhibit the growth of many tumor cells, including small-cell lung cancer, malignant hemopoietic cells, and breast cancer cells.


A3412-50 50 mg
EUR 152
Description: Fenretinide(4HPR) is an inhibitor of Focal adhesion kinase (FAK) [1].Fenretinideis a vitamin A analogue, it has been shown toinhibit the growth of many tumor cells, including small-cell lung cancer, malignant hemopoietic cells, and breast cancer cells.


Single cell transcriptomes reveal expression patterns of chemoreceptor genes in olfactory sensory neurons of the Caribbean spiny lobster, Panulirus argus



Background: Crustaceans categorical quite a lot of programs of receptor genes of their antennules, which house olfactory sensory neurons (OSNs) and non-olfactory chemosensory neurons. Transcriptomics analysis reveal that candidate chemoreceptor proteins embrace variant Ionotropic Receptors (IRs) along with every co-receptor IRs and tuning IRs, Transient Receptor Potential (TRP) channels, Gustatory Receptors, epithelial sodium channels, and class A G-protein coupled receptors (GPCRs). The Caribbean spiny lobster, Panulirus argus, expresses in its antennules nearly 600 IRs, 17 TRP channels, 1 Gustatory Receptor, 7 epithelial sodium channels, 81 GPCRs, 6 G proteins, and dozens of enzymes in signaling pathways.


However, the exact combinatorial expression patterns of these proteins in single sensory neurons normally aren’t acknowledged for any crustacean, limiting our understanding of how their chemosensory strategies encode chemical prime quality.


Outcomes: The aim of this analysis was to utilize transcriptomics to elucidate expression patterns of chemorece


Recombinant Sterol Carrier Protein 2 (SCP2)

  • EUR 433.31
  • EUR 219.00
  • EUR 1349.92
  • EUR 516.64
  • EUR 933.28
  • EUR 353.00
  • EUR 3224.80
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P11915
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 16.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Sterol Carrier Protein 2 expressed in: E.coli

Sterol Carrier Protein 2 (SCP2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

abx026860-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

abx026860-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

abx038200-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

abx034040-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

abx034040-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

abx237652-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

abx237653-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

abx237654-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sterol Carrier Protein 2 (SCP2) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human Sterol Carrier Protein 2 (SCP2) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1692.00
  • EUR 676.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Sterol Carrier Protein 2 (SCP2) Protein

  • EUR 606.00
  • EUR 258.00
  • EUR 1831.00
  • EUR 718.00
  • EUR 439.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Sterol Carrier Protein 2 (SCP2) ELISA Kit

abx383064-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2)

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat)

  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2)

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2). This antibody is labeled with APC.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2). This antibody is labeled with Biotin.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2). This antibody is labeled with Cy3.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2). This antibody is labeled with FITC.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2). This antibody is labeled with HRP.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2). This antibody is labeled with PE.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat), APC

  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2). This antibody is labeled with APC.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat), Biotinylated

  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2). This antibody is labeled with Biotin.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat), Cy3

  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2). This antibody is labeled with Cy3.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat), FITC

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2). This antibody is labeled with FITC.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat), HRP

  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2). This antibody is labeled with HRP.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat), PE

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2). This antibody is labeled with PE.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sterol Carrier Protein 2 (SCP2). This antibody is labeled with APC-Cy7.

Sterol Carrier Protein 2 (SCP2) Polyclonal Antibody (Rat), APC-Cy7

  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCP2 (Ala433~Leu547)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Sterol Carrier Protein 2 (SCP2). This antibody is labeled with APC-Cy7.

Sterol Carrier Protein 2 Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sterol carrier protein 2 Antibody

abx431575-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Anti-Sterol carrier protein 2 antibody

STJ71576 100 µg
EUR 359

SCP2 sterol-binding domain containing 1 Protein

  • EUR 1609.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.

Rabbit Sterol carrier protein 2 ELISA kit

E04S0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Sterol carrier protein 2 ELISA kit

E04S0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Sterol carrier protein 2 ELISA kit

E04S0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Sterol carrier protein 2 ELISA kit

E02S0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Sterol carrier protein 2 ELISA kit

E02S0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Sterol carrier protein 2 ELISA kit

E02S0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Sterol carrier protein 2 ELISA kit

E03S0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Sterol carrier protein 2 ELISA kit

E03S0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Sterol carrier protein 2 ELISA kit

E03S0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Sterol carrier protein 2 ELISA kit

E01S0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Sterol carrier protein 2 ELISA kit

E01S0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Sterol carrier protein 2 ELISA kit

E01S0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Sterol carrier protein 2 ELISA kit

E06S0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Sterol carrier protein 2 ELISA kit

E06S0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Sterol carrier protein 2 ELISA kit

E06S0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Sterol carrier protein 2 ELISA kit

E08S0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Sterol carrier protein 2 ELISA kit

E08S0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Sterol carrier protein 2 ELISA kit

E08S0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Sterol carrier protein 2 ELISA kit

E07S0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Sterol carrier protein 2 ELISA kit

E07S0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Sterol carrier protein 2 ELISA kit

E07S0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Sterol carrier protein 2 ELISA kit

E09S0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Sterol carrier protein 2 ELISA kit

E09S0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Sterol carrier protein 2 ELISA kit

E09S0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

SCP2D1 SCP2 sterol-binding domain containing 1 Human Recombinant Protein

PROTQ9UJQ7 Regular: 10ug
EUR 317
Description: SCP2D1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 179 amino acids (1-156 a.a) and having a molecular mass of 20.1kDa.SCP2D1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Polyclonal Sterol carrier protein 2 Antibody (internal region)

APR10298G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Sterol carrier protein 2 (internal region). This antibody is tested and proven to work in the following applications:

Guinea pig Sterol carrier protein 2 ELISA kit

E05S0001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Sterol carrier protein 2 ELISA kit

E05S0001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Sterol carrier protein 2 ELISA kit

E05S0001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Sterol carrier protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

SCP2 Recombinant Protein (Human)

RP027781 100 ug Ask for price

SCP2 Recombinant Protein (Human)

RP027784 100 ug Ask for price

SCP2 Recombinant Protein (Rat)

RP227723 100 ug Ask for price

SCP2 Recombinant Protein (Mouse)

RP170345 100 ug Ask for price

Recombinant purified (>98%) Human FAS Ligand Protein (carrier free)

FASL15-R-2 2 ug
EUR 347

Scp2/ Rat Scp2 ELISA Kit

ELI-44038r 96 Tests
EUR 886

SCP2 antibody

70R-3015 50 ug
EUR 467
Description: Rabbit polyclonal SCP2 antibody raised against the middle region of SCP2

SCP2 Antibody

39403-100ul 100ul
EUR 390

SCP2 Antibody

43535-100ul 100ul
EUR 252

SCP2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCP2. Recognizes SCP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

SCP2 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SCP2. Recognizes SCP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

SCP2 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SCP2. Recognizes SCP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

SCP2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SCP2. Recognizes SCP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA14533 50 ug
EUR 363
Description: Mouse polyclonal to SCP2


YF-PA14534 100 ug
EUR 403
Description: Rabbit polyclonal to SCP2

Recombinant Human TFF-2 Protein

PROTQ03403-2 20ug
EUR 317
Description: The Trefoil Factor peptides (TFF1, TFF2 and TFF3) are expressed in the gastrointestinal tract, and appear to play an important role in intestinal mucosal defense and repair. TFF2 has been shown to inhibit gastrointestinal motility and gastric acid secretion. Recent data suggests a potential role for TFF2 in acute and chronic asthma (Nikolaidis, N.M. et al. Am. Journal Respir. Cell Mol. Biol. (2003) 4: 458-464). Recombinant human TFF2 is a 12.0 kDa polypeptide of 107 amino acid residues, which includes a 40-amino acid trefoil motif containing three conserved intramolecular disulfide bonds.

Recombinant Human BD-2 Protein

PROTO15263-2 20ug
EUR 317
Description: Defensins (alpha and beta) are cationic peptides with a broad spectrum of antimicrobial activity that comprise an important arm of the innate immune system. The α-defensins are distinguished from the β-defensins by the pairing of their three disulfide bonds. To date, six human β-defensins have been identified; BD-1, BD-2, BD-3, BD-4, BD-5 and BD-6. β-defensins are expressed on some leukocytes and at epithelial surfaces. In addition to their direct antimicrobial activities, they can act as chemoattractants towards immature dendritic cells and memory T cells. The β-defensin proteins are expressed as the C-terminal portion of precursors and are released by proteolytic cleavage of a signal sequence and in some cases, a propeptide sequence. β-defensins contain a six-cysteine motif that forms three intra-molecular disulfide bonds. Recombinant human BD-2 is a 4.3 kDa protein containing 41 amino acid residues.

Recombinant Human Relaxin-2 Protein

PROTP04090-2 25ug
EUR 317
Description: Relaxin-2 is a peptide hormone structurally related to insulin, which is expressed in the placenta, decidua, prostate, and in the ovary during pregnancy. Of the three known relaxin genes, Relaxin-2 is the only relaxin known to circulate in the blood. Relaxin-2 binds specifically to the LGR7 and LGR8 receptors, previously identified as an “orphan” G protein coupled receptors. Signaling by Relaxin-2 through its target receptors enhances the growth of pubic ligaments and ripening of the cervix during birth. Recombinant Relaxin-2 is a nonglycosylated 6.0 kDa disulfide linked heterodimeric protein consisting of a 24 amino acid A-chain and a 29 amino acid B-chain.

Recombinant Murine IL-2 Protein

PROTP04351-2 20ug
EUR 317
Description: IL-2 is a powerful immunoregulatory lymphokine produced by T-cells in response to antigenic or mitogenic stimulation. IL-2/IL-2R signaling is required for T-cell proliferation and other fundamental functions which are essential for the immune response. IL-2 stimulates growth and differentiation of B-cells, NK cells, lymphokine activated killer cells, monocytes, macrophages and oligodendrocytes. Recombinant murine IL-2 is a 17.2 kDa protein, containing 149 amino acid residues.

Recombinant Human PAI-2 Protein

PROTP05120-2 10ug
EUR 317
Description: PAI-2 is an inhibitory serpin expressed mainly in keratinocytes, activated monocytes, and placental trophoblasts. It exists predominantly as a 47 kDa nonglycosylated intracellular protein which can be induced to be secreted as 60 kDa glycoprotein. The glycosylated and unglycosylated forms of PAI-2 are equally effective as inhibitors of urokinase-type plasminogen activator (uPA), the only established physiological target of this serpin. PAI-2 has a unique ability to form dormant polymers spontaneously and reversibly under physiological conditions. The physiological relevance of this property, which is neither a consequence of any mutation in the PAI-2 gene nor associated with any known disorder, is still unclear. However, it appears that the formation of intracellular dormant polymers may be important for the controlled release of the inhibitor from PAI-2 producing cells. Plasma levels of PAI-2 are usually low or undetectable, except during pregnancy and in some forms of monocytic leukemia. Secretion of PAI-2 from the placenta normally occurs during the third trimester of pregnancy and accounts for the dramatic increase in PAI-2 levels (up to 250 ng/ml), which are maintained at these levels until postpartum, and then rapidly decline. In addition to its vital role in protecting the placenta from degradation by uPA and/or uPA-activated proteases, PAI-2 has been shown to be essential for the prevention of metastatic spread of neck, lung and breast cancers. The beneficial effect of PAI-2 seen in these studies is presumed to stem from its ability to inhibit uPA-dependent cell dissemination. PAI-2 has also been reported to inhibit keratinocyte proliferation, and to participate in the innate immune response during viral infection. Recombinant human PAI-2 is a 415-residue nonglycosylated protein.

Recombinant Human MMP-2 Protein

PROTP08253-2 10ug
EUR 317
Description: Matrix metalloproteinases (MMPs) are a family of endoproteases that require zinc and calcium for expressing catalytic activity. These enzymes play a central role in the maintenance and remodeling of the extracellular matrix. Elevated expression of their activity, caused either by up-regulation of their expression or down-regulation of their cognate inhibitors, has been implicated in various degenerative disorders, including arthritis, cardiovascular disease, skeletal growth-plate disorders, and cancer metastasis. MMP-2 is a secreted collagenase with specificity toward Type IV, V, VII, and X collagens. Recombinant human MMP-2 is a 62.0 kDa protein containing the entire catalytic N-terminal domain and the C-terminal domain (552 amino acids).

Mouse FGF-2 Recombinant Protein

R00121-2 5ug/vial
EUR 259
Description: FGF basic (FGF2) is a multipotential fibroblast growth factor that stimulates and supports proliferation, migration and differentiation. Mouse FGF basic (FGF-2) Recombinant Protein is purified FGF basic (FGF-2) produced in yeast.

Chicken IL-2 Recombinant Protein

R00387-2 5ug/vial
EUR 259
Description: Interleukin-2 (IL-2) is a cytokine produced by T-helper cells in response to antigenic or mitogenic stimulation. It is required for T-cell proliferation and other activities crucial to the regulation of the immune response. Chicken IL-2 Recombinant Protein is purified interleukin-2 produced in yeast.

BMP-2 Bone Morphogenetic Protein-2 Human Recombinant Protein, Monomer

PROTP12643-2 Regular: 20ug
EUR 317
Description: Bone Morphogenetic Protein-2 Human Recombinant produced in E.Coli is a monomeric, non-glycosylated, Polypeptide chain containing 115 amino acids (283-396) and having a molecular mass of 13009 Dalton. ;The BMP-2 is purified by proprietary chromatographic techniques.

ErbB2 ErbB-2 Human Recombinant Protein

PROTP04626-2 Regular: 20ug
EUR 317
Description: ErbB-2 Human Recombinant is a 43.4 kDa protein containing 397 amino acid residues of the human Herstatin, and an extra Methionine at N-Terminal (underlined), produced in E.coli.

IL-2 Interleukin-2 Human Recombinant Protein, His Tag

PROTP60568-2 Regular: 10ug
EUR 317
Description: Interleukin-2 Human Recombinant produced in E.Coli is a single, non-glycosylated, Polypeptide chain containing 133 amino acids fragment (21-153) having a molecular weight of 20kDa and fused with a 4.5kDa amino-terminal hexahistidine tag. _x000D_ The IL-2 His is purified by proprietary chromatographic techniques._x000D_

Anti-SCP2 Antibody

EUR 370

SCP2 Blocking Peptide

33R-6715 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SCP2 antibody, catalog no. 70R-3015

SCP2 Conjugated Antibody

C43535 100ul
EUR 397

SCP2 cloning plasmid

CSB-CL020856HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 432
  • Sequence: atgggttttccggaagccgccagttcttttagaactcatcaaattgaagctgttccaaccagctctgcaagtgatggatttaaggcaaatcttgtttttaaggagattgagaagaaacttgaagaggaaggggaacagtttgtgaagaaaatcggtggtatttttgccttcaaggt
  • Show more
Description: A cloning plasmid for the SCP2 gene.

SCP2 cloning plasmid

CSB-CL020856HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 969
  • Sequence: atgtcctcttccccgtgggagcctgcgaccctgcgccgggtgttcgtggtgggggttggcatgaccaagtttgtgaagcctggagctgagaattcaagagactaccctgacttggcagaagaagcaggcaagaaggctttagctgatgcacagatcccttattcagcagtggacca
  • Show more
Description: A cloning plasmid for the SCP2 gene.

SCP2 Rabbit pAb

A5382-100ul 100 ul
EUR 308

SCP2 Rabbit pAb

A5382-200ul 200 ul
EUR 459

SCP2 Rabbit pAb

A5382-20ul 20 ul
EUR 183

SCP2 Rabbit pAb

A5382-50ul 50 ul
EUR 223

SCP2 Polyclonal Antibody

A54392 100 µg
EUR 570.55
Description: reagents widely cited

anti- SCP2 antibody

FNab07652 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: sterol carrier protein 2
  • Uniprot ID: P22307
  • Gene ID: 6342
  • Research Area: Metabolism
Description: Antibody raised against SCP2

anti- SCP2 antibody

FNab07653 100µg
EUR 548.75
  • Immunogen: sterol carrier protein 2
  • Uniprot ID: P22307
  • Gene ID: 6342
  • Research Area: Metabolism
Description: Antibody raised against SCP2

anti- SCP2 antibody

FNab07654 100µg
EUR 585
  • Immunogen: sterol carrier protein 2
  • Uniprot ID: P22307
  • Gene ID: 6342
  • Research Area: Metabolism
Description: Antibody raised against SCP2

Anti-SCP2 antibody

PAab07652 100 ug
EUR 386

Anti-SCP2 antibody

PAab07653 100 ug
EUR 386

Anti-SCP2 antibody

PAab07654 100 ug
EUR 412

Anti-SCP2 antibody

STJ27335 100 µl
EUR 277
Description: This gene encodes two proteins: sterol carrier protein X (SCPx) and sterol carrier protein 2 (SCP2), as a result of transcription initiation from 2 independently regulated promoters. The transcript initiated from the proximal promoter encodes the longer SCPx protein, and the transcript initiated from the distal promoter encodes the shorter SCP2 protein, with the 2 proteins sharing a common C-terminus. Evidence suggests that the SCPx protein is a peroxisome-associated thiolase that is involved in the oxidation of branched chain fatty acids, while the SCP2 protein is thought to be an intracellular lipid transfer protein. This gene is highly expressed in organs involved in lipid metabolism, and may play a role in Zellweger syndrome, in which cells are deficient in peroxisomes and have impaired bile acid synthesis. Alternative splicing of this gene produces multiple transcript variants, some encoding different isoforms.

Recombinant Human TGF-Beta 2 (insect derived) Protein

PROTP61812-2 10ug
EUR 317
Description: The three mammalian isoforms of TGF-β, TGF-β1, β2, β3, signal through the same receptor and elicit similar biological responses. They are multifunctional cytokines that regulate cell proliferation, growth, differentiation and motility as well as synthesis and deposition of the extracellular matrix. They are involved in various physiological processes including embryogenesis, tissue remodeling and wound healing. They are secreted predominantly as latent complexes which are stored at the cell surface and in the extracellular matrix. The release of biologically active TGF-β isoform from a latent complex involves proteolytic processing of the complex and /or induction of conformational changes by proteins such as thrombospondin-1. TGF-β2 has been shown to exert suppressive effects on IL-2 dependent T-cell growth, and may also have an autocrine function in enhancing tumor growth by suppressing immuno-surveillance of tumor development. Recombinant human TGF-β2 is a 25.0 kDa protein composed of two identical 112 amino acid polypeptide chains linked by a single disulfide bond.
* Manufactured using (BTI-Tn-5B1-4) cells under license from the Boyce Thompson Institute for Plant Research, Inc.

Scp2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4797203 1.0 ug DNA
EUR 154

Scp2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6784603 1.0 ug DNA
EUR 154

SCP2 sgRNA CRISPR Lentivector (Human) (Target 2)

K2104303 1.0 ug DNA
EUR 154

AHSG Alpha-2-HS-Glycoprotein Human Recombinant Protein HEK

PROTP02765-2 Regular: 10ug
EUR 317
Description: AHSG Human Recombinant produced by transfected human cells is a single polypeptide chain containing 357 amino acids (19-367). AHSG is fused to an 8 amino acid His-tag at C-terminus & purified by proprietary chromatographic techniques.

FGF-2 Fibroblast Growth Factor-Basic Human Recombinant Protein

PROTP09038-2 Regular: 50ug
EUR 317
Description: Fibroblast Growth Factor-2 Human Recombinant (FGF-2) produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 154 amino acids and having a molecular mass of 17.2kDa.;The FGF-b is purified by proprietary chromatographic techniques.

TIMP2 Tissue Inhibitor of Metalloprotease 2 Human Recombinant Protein

PROTP16035-2 Regular: 20ug
EUR 317
Description: TIMP2 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 194 amino acids and having a molecular mass of 21.8kDa. 

Sterol O-Acyltransferase 2 (SOAT2) Antibody

abx238098-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Sterol O-Acyltransferase 2 (SOAT2) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sterol O-Acyltransferase 2 (SOAT2) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sterol Regulatory Element-Binding Protein 2 (SREBF2) Antibody

abx025838-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Sterol Regulatory Element-Binding Protein 2 (SREBF2) Antibody

abx025838-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Sterol Regulatory Element-Binding Protein 2 (SREBF2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sterol Regulatory Element-Binding Protein 2 (SREBF2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sterol Regulatory Element-Binding Protein 2 (SREBP2) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Sterol Regulatory Element-Binding Protein 2 (SREBF2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sterol Regulatory Element-Binding Protein 2 (SREBF2) Antibody

abx238221-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Sterol regulatory element-binding protein 2 (SREBF2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sterol regulatory element-binding protein 2 (SREBF2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sterol regulatory element-binding protein 2 (SREBF2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PLGF2 Human, Placenta Growth Factor-2 Human Recombinant Protein, CHO

PROTP49763-2 Regular: 25ug
EUR 317
Description: PLGF2 Human Recombinant (19-170 a.a.) produced in CHO is a disulfide-linked homodimeric, glycosylated, polypeptide chain containing 152 amino acids and having a molecular mass of 33kDa.;The PLGF-2 Human Recombinant protein is purified by proprietary chromatographic techniques.

B2M Human, Beta 2 Microglobulin Human Recombinant Protein, His Tag

PROTP61769-2 Regular: 5ug
EUR 317
Description: B2M Recombinant Human produced in E.Coli is a single, non-glycosylated polypeptide chain containing 120 amino acids (1-119 a.a.) and having a molecular mass of 14 kDa. The B2M is fused to a 21 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques.

LCN2 Neutrophil Gelatinase Associated Lipocalin/Lipocalin-2 Human Recombinant Protein

PROTP80188-2 Regular: 10ug
EUR 317
Description: LCN2 Human Recombinant produced in E.Coli is a homodimeric non-glycosylated polypeptide chains consisting of two 178 amino acids and having a molecular mass of 41.0kDa. 

TNFR2 Tumor Necrosis Factor Receptor Type 2 Human Recombinant Protein

PROTP20333-2 Regular: 20ug
EUR 317
Description: TNFR2 Human produced in E.Coli is a single, non-glycosylated polypeptide chain containing 184 amino acids and having a molecular mass of 20kDa. The TNFR2 is purified by proprietary chromatographic techniques.

Recombinant human Sterol regulatory element-binding protein 2 (SREBP2) protein control for WB

SREBP23-C 100 ul
EUR 286


EF002763 96 Tests
EUR 689

Mouse SCP2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat SCP2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SCP2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCP2. Recognizes SCP2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SCP2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCP2. Recognizes SCP2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SCP2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCP2. Recognizes SCP2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human SCP2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-SCP2 (2E9-1B3)

YF-MA15348 100 ug
EUR 363
Description: Mouse monoclonal to SCP2

DCTN2 (1-403) Dynactin 2 (1-403 a.a.) Human Recombinant Protein

PROTQ13561-2 Regular: 20ug
EUR 317
Description: Dynactin 2 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 426 amino acids (1-403 a.a) and having a molecular mass of 46.9kDa.;DCTN2 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

RARRES2 Human, Retinoic Acid Receptor Responder 2 Human Recombinant Protein,Sf9

PROTQ99969-2 Regular: 5ug
EUR 317
Description: RARRES2 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 146 amino acids (21-157a.a.) and having a molecular mass of 16.9kDa. (Molecular size on SDS-PAGE will appear at approximately 18-28kDa). RARRES2 is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

Viral Nucleic Acid Extraction Kit I (300prep), (With Carrier RNA, for low viral load specimen using carrier RNA)

FAVNK-001-2 300 preps
EUR 397

Streptavidin Recombinant Protein

PROTP22629-2 Regular: 20mg
EUR 317
Description: Streptavidin Streptomyces Avidinii Recombinant produced in E.Coli. ;The molecular weight per tetramer is approximately 52kDa.

Sterol regulatory element-binding protein 2 (SREBF2) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Sterol regulatory element-binding protein 2 (SREBF2) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Sterol regulatory element-binding protein 2 (SREBF2) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant Acyl Carrier Protein, Mitochondrial (ACP)

  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O14561
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.7kDa
  • Isoelectric Point: 6.7
Description: Recombinant Human Acyl Carrier Protein, Mitochondrial expressed in: E.coli

Recombinant Acyl Carrier Protein, Mitochondrial (ACP)

  • EUR 526.50
  • EUR 244.00
  • EUR 1699.36
  • EUR 633.12
  • EUR 1166.24
  • EUR 415.00
  • EUR 4098.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9CR21
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.9kDa
  • Isoelectric Point: 7.8
Description: Recombinant Mouse Acyl Carrier Protein, Mitochondrial expressed in: E.coli

Recombinant Oxoglutarate Carrier Protein, Mitochondrial (OGC)

  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q02978
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 37.8kDa
  • Isoelectric Point: 9.9
Description: Recombinant Human Oxoglutarate Carrier Protein, Mitochondrial expressed in: E.coli

a.a.), TRAIL/APO 2 Ligand (114-281 a.a.) Human Recombinant Protein, Active

PROTP50591-2 Regular: 10ug
EUR 317
Description: Soluble TNF-related apoptosis-inducing ligand Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 169 amino acids _x000D_ (114-281) and having a molecular mass of 19.6 kDa._x000D_ The sTRAIL is purified by proprietary chromatographic techniques.

SLC3A2 Solute Carrier Family 3 Member 2 Human Recombinant Protein

PROTP08195 Regular: 10ug
EUR 317
Description: SLC3A2 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 434 amino acids (206-630a.a.) and having a molecular mass of 47.9kDa. (Molecular size on SDS-PAGE will appear at approximately 40-57kDa).;SLC3A2 is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

Recombinant Human Sterol O-Acyltransferase 2/SOAT2/ACAT2 (N-Trx, 6His)

CG82-10ug 10ug
EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Sterol O-Acyltransferase 2/SOAT2/ACAT2 (N-Trx, 6His)

CG82-1mg 1mg
EUR 2486
Description: Supplied as a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Sterol O-Acyltransferase 2/SOAT2/ACAT2 (N-Trx, 6His)

CG82-500ug 500ug
EUR 1755
Description: Supplied as a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human Sterol O-Acyltransferase 2/SOAT2/ACAT2 (N-Trx, 6His)

CG82-50ug 50ug
EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human NOV Protein

PROTP48745-2 20ug
EUR 317
Description: NOV is a member of the CCN family of secreted cysteine rich regulatory proteins. The full length NOV protein contains four structural domains that confer distinct, and sometimes opposing, biological activities. Elevated expression of NOV is associated with certain tumors, including Wilm’s tumor and most nephroblastomas. However, in other tumor types and certain cancer cell lines, increased tumorgenicity and proliferation is correlated with decreased NOV expression. Additionally, NOV induces cell adhesion and cell migration by signaling through specific cell surface integrins and by binding to heparin sulfate proteoglycans and to fibulin 1C. NOV has also been reported to exert proangiogenic activities. Recombinant human NOV is a 36.2 kDa protein containing 331 amino acid residues. It is composed of four distinct structural domains (modules); the IGF binding protein (IGFBP) domain, the von Willebrand Factor C (VWFC) domain, the Thrombospondin type-I (TSP type-1) domain, and a C-terminal cysteine knot-like domain (CTCK).

Recombinant Rat Leptin Protein

PROTP50596-2 1mg
EUR 317
Description: Encoded by the ob (obese) gene, Leptin is an adipose-derived cytokine that suppresses appetite and increases thermogenesis. Leptin exerts its anorectic effect via signaling through a hypothalamic receptor termed OB-R. Leptin has been shown to reduce body weight, food consumption, and plasma glucose levels in various in vivo models. Recombinant Rat Leptin is a 16.2 kDa protein containing 147 amino acid residues.

Recombinant Human MANF Protein

PROTP55145-2 25ug
EUR 317
Description: MANF is a secreted neurotrophic factor that is expressed in brain, neuronal and certain non-neuronal tissues. It has been shown to promote survival, growth and function of dopamine specific neurons. MANF and its structural homolog CDNF, each contain an N-terminal saposin-like lipid binding domain, and a carboxyl-terminal domain, which is not homologous to previously characterized protein structures. MANF and CDNF can prevent 6-OHDA induced degeneration of dopaminergic neurons by triggering survival pathways in a rat experimental model of Parkinson disease. Recombinant human MANF is an 18.1 kDa protein consisting of 158 amino acids including 8 cysteine residues.

Recombinant Human Enterokinase Protein

PROTP98073-2 50ug
EUR 317
Description: Proteases (also called Proteolytic Enzymes, Peptidases, or Proteinases) are enzymes that hydrolyze the amide bonds within proteins or peptides. Most proteases act in a specific manner, hydrolyzing bonds at or adjacent to specific residues or a specific sequence of residues contained within the substrate protein or peptide. Proteases play an important role in most diseases and biological processes including prenatal and postnatal development, reproduction, signal transduction, the immune response, various autoimmune and degenerative diseases, and cancer. They are also an important research tool, frequently used in the analysis and production of proteins. Enterokinase sequentially cleaves carboxyl side of D-D-D-D-K. Human Enterokinase is expressed as a linear 1019 amino acid polypeptide precursor glycoprotein. Proteolytic processing of this precursor generates the biologically active form of Enterokinase, which consists of two polypeptide chains (heavy chain and light chain) held together by a single disulfide bond, resulting in formation of a biologically active heterodimer. The heavy chain consists of 784 amino acid residues, and the light consists of 235 amino acid residues.

Recombinant Human MIA Protein

PROTQ16674-2 20ug
EUR 317
Description: MIA is the first discovered member of a family of secreted cytokines termed the MIA/OTOR family. The four known members of this family; MIA, MIA2, OTOR and TANGO each contain a Src homology-3 (SH3)-like domain. MIA is an autocrine growth regulatory protein secreted from chondrocytes and malignant melanoma cells that promotes melanoma metastasis by binding competitively to fibronectin and laminin in a manner that results in melanoma cell detachment from the extracellular matrix in vivo. Elevated levels of MIA may represent a clinically useful marker for diagnosis of melanoma metastasis as well as a potential marker for rheumatoid arthritis. Recombinant human MIA is a 12.2 kDa globular protein containing 108 amino acid residues including two intramolecular disulfide bonds.

Recombinant Human TSLP Protein

PROTQ969D9-2 10ug
EUR 317
Description: TSLP is a hemopoietic protein that is expressed in the heart, liver and prostate. TSLP overlaps biological activities with IL-7 and binds with the heterodimeric receptor complex consisting of the IL-7R α chain (IL-7Rα) and the TSLP-specific chain (TSLPR). Like IL-7, TSLP induces phosphorylation of STAT3 and STAT5, but uses kinases other than the JAKs for activation. TSLP prohibited apoptosis and stimulated growth of the human acute myeloid leukemia (AML)-derived cell line MUTZ3. It induces the release of T cell-attracting chemokines TARC and MDC from monocytes and activates CD11c(+) dendritic cells (DCs). TSLP activated DCs primed naïve T cells to produce the proallergic cytokines (IL-4, IL-5, IL-13, TNFα) while down-regulating IL-10 and IFN-γ suggesting a role in initiating allergic inflammation. Recombinant human TSLP is a 15.0 kDa protein consisting of 132 amino acid residues.

Recombinant Human Neuroserpin Protein

PROTQ99574-2 25ug
EUR 317
Description: Neuroserpin is an inhibitory serpin that is expressed predominantly in central nervous system. Although the physiological target of neuroserpin is still unclear, cumulative evidence suggest that it plays an important role in controlling proteolytic degradation of extracellular matrix (ECM) during synaptogenesis and the subsequent development of neuronal plasticity. In the adult brain, neuroserpin is secreted from the growth cones of neurons in areas where synaptic changes are associated with learning and memory, i.e. cerebral cortex, hippocampus, and amygdala. The neuroprotective role of neuroserpin has been demonstrated in transgenic mice lacking neuroserpin expression. The deficiency of neuroserpin in these mice was associated with motor neuron disease characterized by axonal degradation. In humans, defects in neuroserpin, caused by point mutations in the neuroserpin gene, underlie a hereditary disorder called the familial encephalopathy with neuroserpin inclusion bodies (FENIB). Recombinant human neuroserpin is a 44.8 kDa non-glycosylated protein containing 395 amino-acid residues.

NANOG Human Recombinant Protein

PROTQ9H9S0-2 Regular: 20ug
EUR 317
Description: NANOG Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 305 amino acids (1-305) and having a molecular mass of 34.6 kDa.;The NANOG is purified by proprietary chromatographic techniques.

Recombinant Human Neuritin Protein

PROTQ9NPD7-2 20ug
EUR 317
Description: Neuritin is a neurotrophic factor, which is expressed in response to induction of neuronal activity by NGF, BDNF, NT3, and other neural stimulators. It is expressed primarily in postmitotic-differentiating neurons of the developing nervous system and in neuronal structures related to synaptic plasticity in the adult nervous system. Neuritin acts as a molecular mediator of neurite outgrowth, neuronal survival, and synaptic maturation. Recombinant human Neuritin is a covalently disulfide-linked homodimer, consisting of two 9.72 kDa polypeptide monomers, each containing 88 amino acid residues.

TIGAR Human Recombinant Protein

PROTQ9NQ88-2 Regular: 25ug
EUR 317
Description: TIGAR Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 270 amino acids and having a molecular mass of 30.1kDa. The TIGAR is purified by proprietary chromatographic techniques.

Recombinant Human OTOR Protein

PROTQ9NRC9-2 20ug
EUR 317
Description: OTOR, also called Otoraplin and MIAL, is a secreted cytokine and a member of the MIA/OTOR family. Members of this family which also includes MIA, MIA2, and TANGO share a Src homology-3 (SH3)-like domain. OTOR is predominantly expressed in the cochlea of the inner-ear and to a lesser extent in fetal brain and in some cartilage tissues. OTOR appears to be involved in early chondrogenesis of the otic capsule, which is required for normal inner ear development and auditory function. Recombinant human OTOR is a 12.7 kDa globular protein containing 112 amino acid residues.

Recombinant Human Epiregulin Protein

PROTO14944-2 25ug
EUR 317
Description: Epiregulin is an EGF related growth factor that binds specifically to EGFR (ErbB1) and ErbB4, but not ErbB2 or ErbB3. It is expressed mainly in the placenta and peripheral blood leukocytes and in certain carcinomas of the bladder, lung, kidney and colon. Epiregulin stimulates the proliferation of keratinocytes, hepatocytes, fibroblasts and vascular smooth muscle cells. It also inhibits the growth of several tumor-derived epithelial cell lines. Human Epiregulin is initially synthesized as a glycosylated 19.0 kDa transmembrane precursor protein, which is processed by proteolytic cleavage to produce a 6.0 kDa mature secreted sequence. Recombinant human Epiregulin is a 5.6 kDa monomeric protein, containing 50 amino residues, which corresponds to the mature secreted Epiregulin sequence.

Recombinant Human LIGHT Protein

PROTO43557-2 15ug
EUR 317
Description: LIGHT belongs to the TNF family of ligands, and can signal through the herpes virus entry mediator type A receptor (HVEM, TNFRSF14), LTβR, or bind to a decoy receptor, DcR3. It is expressed in splenocytes, activated PBL, CD+8 tumor infiltrating lymphocytes, granulocytes, and monocytes. LIGHT has the ability to active NFκB, to co-stimulate the activation of lymphocytes and to induce apoptosis in certain human tumor cells. Recombinant human LIGHT has a calculated mass of 19.3 kDa containing 177 amino acid residues. Due to glycosylation LIGHT migrates between 20.0-22.5 kDa by SDS-PAGE under non-reducing conditions.

*Human LIGHT(Catalog Number 310-09B) has replaced Human LIGHT(Catalog Number 310-09)