ATG9B Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

ATG9B Polyclonal Antibody
ABP57839-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ATG9B protein
  • Applications tips:
Description: A polyclonal antibody for detection of ATG9B from Human, Mouse. This ATG9B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ATG9B protein

ATG9B Polyclonal Antibody
ABP57839-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ATG9B protein
  • Applications tips:
Description: A polyclonal antibody for detection of ATG9B from Human, Mouse. This ATG9B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ATG9B protein

ATG9B Polyclonal Antibody
30919-100ul 100ul
EUR 252

ATG9B Polyclonal Antibody
30919-50ul 50ul
EUR 187

ATG9B Rabbit pAb
A7406-100ul 100 ul
EUR 308

ATG9B Rabbit pAb
A7406-200ul 200 ul
EUR 459

ATG9B Rabbit pAb
A7406-20ul 20 ul
EUR 183

ATG9B Rabbit pAb
A7406-50ul 50 ul
EUR 223

Polyclonal ATG9B Antibody (CT)
APG02070G 0.1mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATG9B (CT). This antibody is tested and proven to work in the following applications:

ATG9B Polyclonal Conjugated Antibody
C30919 100ul
EUR 397

ATG9B antibody
70R-9615 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal ATG9B antibody

ATG9B Antibody
25131-100ul 100ul
EUR 390

ATG9B Antibody
1-CSB-PA721119ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ATG9B. Recognizes ATG9B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Polyclonal ATG9B Antibody (C-Terminus)
APG02069G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATG9B (C-Terminus). This antibody is tested and proven to work in the following applications:

ATG9B Antibody (CT)
5065-100
EUR 403

Anti-ATG9B antibody
STJ29543 100 µl
EUR 277
Description: This gene functions in the regulation of autophagy, a lysosomal degradation pathway. This gene also functions as an antisense transcript in the posttranscriptional regulation of the endothelial nitric oxide synthase 3 gene, which has 3' overlap with this gene on the opposite strand. Mutations in this gene and disruption of the autophagy process have been associated with multiple cancers. Alternative splicing results in multiple transcript variants.

Anti-ATG9B antibody
STJ192026 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ATG9B

ATG9B siRNA
20-abx908474
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ATG9B siRNA
20-abx908475
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Antibody for Human ATG9B
SPC-646D 0.1mg
EUR 354
  • ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
  • Show more
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is unconjugated.

Antibody for Human ATG9B
SPC-646D-A390 0.1mg
EUR 401
  • ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
  • Show more
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to ATTO 390.

Antibody for Human ATG9B
SPC-646D-A488 0.1mg
EUR 400
  • ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
  • Show more
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to ATTO 488.

Antibody for Human ATG9B
SPC-646D-A565 0.1mg
EUR 400
  • ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
  • Show more
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to ATTO 565.

Antibody for Human ATG9B
SPC-646D-A594 0.1mg
EUR 400
  • ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
  • Show more
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to ATTO 594.

Antibody for Human ATG9B
SPC-646D-A633 0.1mg
EUR 400
  • ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
  • Show more
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to ATTO 633.

Antibody for Human ATG9B
SPC-646D-A655 0.1mg
EUR 400
  • ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
  • Show more
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to ATTO 655.

Antibody for Human ATG9B
SPC-646D-A680 0.1mg
EUR 400
  • ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
  • Show more
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to ATTO 680.

Antibody for Human ATG9B
SPC-646D-A700 0.1mg
EUR 400
  • ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
  • Show more
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to ATTO 700.

Antibody for Human ATG9B
SPC-646D-ALP 0.1mg
EUR 394
  • ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
  • Show more
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to Alkaline Phosphatase.

Antibody for Human ATG9B
SPC-646D-APC 0.1mg
EUR 399
  • ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
  • Show more
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to APC .

Antibody for Human ATG9B
SPC-646D-APCCY7 0.1mg
EUR 471
  • ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
  • Show more
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to APC/Cy7.

Antibody for Human ATG9B
SPC-646D-BI 0.1mg
EUR 396
  • ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
  • Show more
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to Biotin.

Antibody for Human ATG9B
SPC-646D-DY350 0.1mg
EUR 414
  • ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
  • Show more
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to Dylight 350.

Antibody for Human ATG9B
SPC-646D-DY405 0.1mg
EUR 403
  • ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
  • Show more
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to Dylight 405.

Antibody for Human ATG9B
SPC-646D-DY488 0.1mg
EUR 393
  • ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
  • Show more
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to Dylight 488.

Antibody for Human ATG9B
SPC-646D-DY594 0.1mg
EUR 395
  • ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
  • Show more
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to Dylight 594.

Antibody for Human ATG9B
SPC-646D-DY633 0.1mg
EUR 390
  • ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
  • Show more
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to Dylight 633.

Antibody for Human ATG9B
SPC-646D-FITC 0.1mg
EUR 392
  • ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
  • Show more
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to FITC.

Antibody for Human ATG9B
SPC-646D-HRP 0.1mg
EUR 388
  • ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
  • Show more
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to HRP.

Antibody for Human ATG9B
SPC-646D-P594 0.1mg
EUR 407
  • ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
  • Show more
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to PE/ATTO 594.

Antibody for Human ATG9B
SPC-646D-PCP 0.1mg
EUR 399
  • ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
  • Show more
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to PerCP.

Antibody for Human ATG9B
SPC-646D-RPE 0.1mg
EUR 397
  • ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
  • Show more
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to RPE .

Antibody for Human ATG9B
SPC-646D-STR 0.1mg
EUR 398
  • ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
  • Show more
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to Streptavidin.

Antibody for Human ATG9B
SPC-646S 0.012mg
EUR 65
  • ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
  • Show more
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is unconjugated.

ATG9B Blocking Peptide
33R-9949 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ATG9B antibody, catalog no. 70R-9615

ATG9B cloning plasmid
CSB-CL721119HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1233
  • Sequence: ATGCCATCCTACCCTCAGCCCAGTGTGCTGAGAGGATCCGCTCCAGCCCGCTGCTGGTCCTCCTCCTGGTCCTGGCTGCCGGCTTCTGGCTGGTCCAACTGCTTCGCTCAGTCTGCAACCTCTTCAGCTACTGGGACATCCAGGTGTTTTACAGGGAGGCCCTGCACATCCCCCC
  • Show more
Description: A cloning plasmid for the ATG9B gene.

Rabbit Autophagy related protein 9B(ATG9B) ELISA kit
E04A1752-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Autophagy related protein 9B(ATG9B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Autophagy related protein 9B(ATG9B) ELISA kit
E04A1752-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Autophagy related protein 9B(ATG9B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Autophagy related protein 9B(ATG9B) ELISA kit
E04A1752-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Autophagy related protein 9B(ATG9B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Autophagy Related Protein 9B (ATG9B) Antibody
20-abx006484
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Autophagy Related Protein 9B (ATG9B) Antibody
20-abx320322
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Autophagy Related Protein 9B (ATG9B) Antibody
abx412187-01mg 0.1 mg
EUR 537
  • Shipped within 1 week.

Autophagy Related Protein 9B (ATG9B) Antibody
abx448518-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.

Autophagy Related Protein 9B (ATG9B) Antibody
20-abx225052
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mouse ATG9B shRNA Plasmid
20-abx980837
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ATG9B ELISA KIT|Human
EF004648 96 Tests
EUR 689

Human ATG9B shRNA Plasmid
20-abx967140
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-Flag-ATG9B Plasmid
PVTB01040-2a 2 ug
EUR 356

Autophagy Related Protein 9B (ATG9B) Antibody (ALP)
abx447971-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Autophagy Related Protein 9B (ATG9B) Antibody (APC)
abx447972-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Autophagy Related Protein 9B (ATG9B) Antibody (Biotin)
abx447973-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Autophagy Related Protein 9B (ATG9B) Antibody (FITC)
abx447974-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

Autophagy Related Protein 9B (ATG9B) Antibody (HRP)
abx447975-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

Autophagy Related Protein 9B (ATG9B) Antibody (PerCP)
abx447977-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Autophagy Related Protein 9B (ATG9B) Antibody (RPE)
abx447978-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Autophagy Related Protein 9B (ATG9B) Antibody (Streptavidin)
abx447979-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Atg9b ORF Vector (Mouse) (pORF)
ORF039267 1.0 ug DNA
EUR 506

ATG9B ORF Vector (Human) (pORF)
ORF012271 1.0 ug DNA
EUR 354

Atg9b ORF Vector (Rat) (pORF)
ORF063781 1.0 ug DNA
EUR 506

Autophagy Related Protein 9B (ATG9B) Antibody (ATTO 390)
abx447963-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Autophagy Related Protein 9B (ATG9B) Antibody (ATTO 488)
abx447964-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Autophagy Related Protein 9B (ATG9B) Antibody (ATTO 565)
abx447965-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Autophagy Related Protein 9B (ATG9B) Antibody (ATTO 594)
abx447966-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Autophagy Related Protein 9B (ATG9B) Antibody (ATTO 633)
abx447967-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Autophagy Related Protein 9B (ATG9B) Antibody (ATTO 655)
abx447968-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Autophagy Related Protein 9B (ATG9B) Antibody (ATTO 680)
abx447969-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Autophagy Related Protein 9B (ATG9B) Antibody (ATTO 700)
abx447970-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

ATG9B sgRNA CRISPR Lentivector set (Human)
K0142701 3 x 1.0 ug
EUR 339

Atg9b sgRNA CRISPR Lentivector set (Mouse)
K4690901 3 x 1.0 ug
EUR 339

Atg9b sgRNA CRISPR Lentivector set (Rat)
K6706201 3 x 1.0 ug
EUR 339

Autophagy Related Protein 9B (ATG9B) Antibody (PE/ATTO 594)
abx447976-100ug 100 ug
EUR 592
  • Shipped within 5-12 working days.

ATG9B sgRNA CRISPR Lentivector (Human) (Target 1)
K0142702 1.0 ug DNA
EUR 154

ATG9B sgRNA CRISPR Lentivector (Human) (Target 2)
K0142703 1.0 ug DNA
EUR 154

ATG9B sgRNA CRISPR Lentivector (Human) (Target 3)
K0142704 1.0 ug DNA
EUR 154

Atg9b sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4690902 1.0 ug DNA
EUR 154

Atg9b sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4690903 1.0 ug DNA
EUR 154

Atg9b sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4690904 1.0 ug DNA
EUR 154

Atg9b sgRNA CRISPR Lentivector (Rat) (Target 1)
K6706202 1.0 ug DNA
EUR 154

Atg9b sgRNA CRISPR Lentivector (Rat) (Target 2)
K6706203 1.0 ug DNA
EUR 154

Atg9b sgRNA CRISPR Lentivector (Rat) (Target 3)
K6706204 1.0 ug DNA
EUR 154

ATG9B Protein Vector (Human) (pPB-C-His)
PV049081 500 ng
EUR 481

ATG9B Protein Vector (Human) (pPB-N-His)
PV049082 500 ng
EUR 481

ATG9B Protein Vector (Human) (pPM-C-HA)
PV049083 500 ng
EUR 481

ATG9B Protein Vector (Human) (pPM-C-His)
PV049084 500 ng
EUR 481

pGEX-4T-1-ATG9B(650-900aa) Plasmid
PVTB01040-1a 2 ug
EUR 356

ATG9B Protein Vector (Human) (pPB-His-MBP)
PV324814 500 ng
EUR 481

ATG9B Protein Vector (Human) (pPB-His-GST)
PV324815 500 ng
EUR 481

ATG9B Protein Vector (Rat) (pPB-C-His)
PV255122 500 ng
EUR 1166

ATG9B Protein Vector (Rat) (pPB-N-His)
PV255123 500 ng
EUR 1166

ATG9B Protein Vector (Rat) (pPM-C-HA)
PV255124 500 ng
EUR 1166

ATG9B Protein Vector (Rat) (pPM-C-His)
PV255125 500 ng
EUR 1166

ATG9B Protein Vector (Mouse) (pPB-C-His)
PV157066 500 ng
EUR 1065

ATG9B Protein Vector (Mouse) (pPB-N-His)
PV157067 500 ng
EUR 1065

ATG9B Protein Vector (Mouse) (pPM-C-HA)
PV157068 500 ng
EUR 1065

ATG9B Protein Vector (Mouse) (pPM-C-His)
PV157069 500 ng
EUR 1065

Atg9b 3'UTR Luciferase Stable Cell Line
TU201034 1.0 ml Ask for price

Atg9b 3'UTR GFP Stable Cell Line
TU152277 1.0 ml Ask for price

ATG9B 3'UTR Luciferase Stable Cell Line
TU001345 1.0 ml
EUR 2333

Atg9b 3'UTR Luciferase Stable Cell Line
TU102277 1.0 ml Ask for price

ATG9B 3'UTR GFP Stable Cell Line
TU051345 1.0 ml
EUR 2333

Atg9b 3'UTR GFP Stable Cell Line
TU251034 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody
ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody
ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody
ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody
ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody
ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody
ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody
ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody
ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody
ABP57570-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody
ABP57570-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody
ABP57571-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK3 Rabbit Polyclonal Antibody
ABP57572-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

JNK3 Rabbit Polyclonal Antibody
ABP57572-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

MEK2 Rabbit Polyclonal Antibody
ABP57573-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody
ABP57573-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK2 Rabbit Polyclonal Antibody
ABP57573-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

MEK3 Rabbit Polyclonal Antibody
ABP57574-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody
ABP57574-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

MEK3 Rabbit Polyclonal Antibody
ABP57574-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

Nrf2 Rabbit Polyclonal Antibody
ABP57575-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody
ABP57575-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

Nrf2 Rabbit Polyclonal Antibody
ABP57575-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Nrf2
  • Applications tips:
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

ATG4a Rabbit Polyclonal Antibody
ABP57576-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG4a
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody
ABP57576-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG4a
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4a Rabbit Polyclonal Antibody
ABP57576-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG4a
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

ATG4b Rabbit Polyclonal Antibody
ABP57577-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG4b
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4b Rabbit Polyclonal Antibody
ABP57577-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG4b
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4b Rabbit Polyclonal Antibody
ABP57577-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG4b
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

ATG4c Rabbit Polyclonal Antibody
ABP57578-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG4c
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG4c Rabbit Polyclonal Antibody
ABP57578-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG4c
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG4c Rabbit Polyclonal Antibody
ABP57578-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG4c
  • Applications tips:
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

ATG5 Rabbit Polyclonal Antibody
ABP57579-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG5
  • Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG5 Rabbit Polyclonal Antibody
ABP57579-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG5
  • Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG5 Rabbit Polyclonal Antibody
ABP57579-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG5
  • Applications tips:
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

ATG7 Rabbit Polyclonal Antibody
ABP57580-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG7
  • Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG7 Rabbit Polyclonal Antibody
ABP57580-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG7
  • Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG7 Rabbit Polyclonal Antibody
ABP57580-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG7
  • Applications tips:
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

ATG13 Rabbit Polyclonal Antibody
ABP57581-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG13
  • Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57581-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG13
  • Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57581-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG13
  • Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57582-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATG13
  • Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57582-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATG13
  • Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG13 Rabbit Polyclonal Antibody
ABP57582-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATG13
  • Applications tips:
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

ATG9B Rabbit Polyclonal Antibody