ATG9B Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
ATG9B Polyclonal Antibody |
ABP57839-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human ATG9B protein
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG9B from Human, Mouse. This ATG9B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ATG9B protein |
ATG9B Polyclonal Antibody |
ABP57839-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human ATG9B protein
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG9B from Human, Mouse. This ATG9B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ATG9B protein |
ATG9B Polyclonal Antibody |
30919-100ul |
SAB |
100ul |
EUR 252 |
ATG9B Polyclonal Antibody |
30919-50ul |
SAB |
50ul |
EUR 187 |
ATG9B Rabbit pAb |
A7406-100ul |
Abclonal |
100 ul |
EUR 308 |
ATG9B Rabbit pAb |
A7406-200ul |
Abclonal |
200 ul |
EUR 459 |
ATG9B Rabbit pAb |
A7406-20ul |
Abclonal |
20 ul |
EUR 183 |
ATG9B Rabbit pAb |
A7406-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal ATG9B Antibody (CT) |
APG02070G |
Leading Biology |
0.1mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATG9B (CT). This antibody is tested and proven to work in the following applications: |
ATG9B Polyclonal Conjugated Antibody |
C30919 |
SAB |
100ul |
EUR 397 |
ATG9B antibody |
70R-9615 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal ATG9B antibody |
ATG9B Antibody |
25131-100ul |
SAB |
100ul |
EUR 390 |
ATG9B Antibody |
1-CSB-PA721119ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against ATG9B. Recognizes ATG9B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
Polyclonal ATG9B Antibody (C-Terminus) |
APG02069G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATG9B (C-Terminus). This antibody is tested and proven to work in the following applications: |
ATG9B Antibody (CT) |
5065-100 |
Biovision |
|
EUR 403 |
Anti-ATG9B antibody |
STJ29543 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene functions in the regulation of autophagy, a lysosomal degradation pathway. This gene also functions as an antisense transcript in the posttranscriptional regulation of the endothelial nitric oxide synthase 3 gene, which has 3' overlap with this gene on the opposite strand. Mutations in this gene and disruption of the autophagy process have been associated with multiple cancers. Alternative splicing results in multiple transcript variants. |
Anti-ATG9B antibody |
STJ192026 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to ATG9B |
ATG9B siRNA |
20-abx908474 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ATG9B siRNA |
20-abx908475 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Antibody for Human ATG9B |
SPC-646D |
Stressmarq |
0.1mg |
EUR 354 |
- ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
- Show more
|
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is unconjugated. |
Antibody for Human ATG9B |
SPC-646D-A390 |
Stressmarq |
0.1mg |
EUR 401 |
- ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
- Show more
|
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to ATTO 390. |
Antibody for Human ATG9B |
SPC-646D-A488 |
Stressmarq |
0.1mg |
EUR 400 |
- ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
- Show more
|
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to ATTO 488. |
Antibody for Human ATG9B |
SPC-646D-A565 |
Stressmarq |
0.1mg |
EUR 400 |
- ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
- Show more
|
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to ATTO 565. |
Antibody for Human ATG9B |
SPC-646D-A594 |
Stressmarq |
0.1mg |
EUR 400 |
- ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
- Show more
|
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to ATTO 594. |
Antibody for Human ATG9B |
SPC-646D-A633 |
Stressmarq |
0.1mg |
EUR 400 |
- ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
- Show more
|
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to ATTO 633. |
Antibody for Human ATG9B |
SPC-646D-A655 |
Stressmarq |
0.1mg |
EUR 400 |
- ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
- Show more
|
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to ATTO 655. |
Antibody for Human ATG9B |
SPC-646D-A680 |
Stressmarq |
0.1mg |
EUR 400 |
- ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
- Show more
|
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to ATTO 680. |
Antibody for Human ATG9B |
SPC-646D-A700 |
Stressmarq |
0.1mg |
EUR 400 |
- ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
- Show more
|
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to ATTO 700. |
Antibody for Human ATG9B |
SPC-646D-ALP |
Stressmarq |
0.1mg |
EUR 394 |
- ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
- Show more
|
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to Alkaline Phosphatase. |
Antibody for Human ATG9B |
SPC-646D-APC |
Stressmarq |
0.1mg |
EUR 399 |
- ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
- Show more
|
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to APC . |
Antibody for Human ATG9B |
SPC-646D-APCCY7 |
Stressmarq |
0.1mg |
EUR 471 |
- ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
- Show more
|
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to APC/Cy7. |
Antibody for Human ATG9B |
SPC-646D-BI |
Stressmarq |
0.1mg |
EUR 396 |
- ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
- Show more
|
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to Biotin. |
Antibody for Human ATG9B |
SPC-646D-DY350 |
Stressmarq |
0.1mg |
EUR 414 |
- ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
- Show more
|
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to Dylight 350. |
Antibody for Human ATG9B |
SPC-646D-DY405 |
Stressmarq |
0.1mg |
EUR 403 |
- ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
- Show more
|
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to Dylight 405. |
Antibody for Human ATG9B |
SPC-646D-DY488 |
Stressmarq |
0.1mg |
EUR 393 |
- ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
- Show more
|
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to Dylight 488. |
Antibody for Human ATG9B |
SPC-646D-DY594 |
Stressmarq |
0.1mg |
EUR 395 |
- ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
- Show more
|
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to Dylight 594. |
Antibody for Human ATG9B |
SPC-646D-DY633 |
Stressmarq |
0.1mg |
EUR 390 |
- ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
- Show more
|
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to Dylight 633. |
Antibody for Human ATG9B |
SPC-646D-FITC |
Stressmarq |
0.1mg |
EUR 392 |
- ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
- Show more
|
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to FITC. |
Antibody for Human ATG9B |
SPC-646D-HRP |
Stressmarq |
0.1mg |
EUR 388 |
- ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
- Show more
|
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to HRP. |
Antibody for Human ATG9B |
SPC-646D-P594 |
Stressmarq |
0.1mg |
EUR 407 |
- ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
- Show more
|
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to PE/ATTO 594. |
Antibody for Human ATG9B |
SPC-646D-PCP |
Stressmarq |
0.1mg |
EUR 399 |
- ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
- Show more
|
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to PerCP. |
Antibody for Human ATG9B |
SPC-646D-RPE |
Stressmarq |
0.1mg |
EUR 397 |
- ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
- Show more
|
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to RPE . |
Antibody for Human ATG9B |
SPC-646D-STR |
Stressmarq |
0.1mg |
EUR 398 |
- ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
- Show more
|
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is conjugated to Streptavidin. |
Antibody for Human ATG9B |
SPC-646S |
Stressmarq |
0.012mg |
EUR 65 |
- ATG9B is involved in autophagy and cytoplasm to vacuole transport (Cvt) vesicle formation. Plays a key role in the organization of the preautophagosomal structure/phagophore assembly site (PAS), the nucleating site for formation of the sequestering v
- Show more
|
Description: A polyclonal antibody for ATG9B from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide from the N-terminal of Human ATG9B (aa. 110-121). The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100). This ATG9B antibody is unconjugated. |
ATG9B Blocking Peptide |
33R-9949 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ATG9B antibody, catalog no. 70R-9615 |
ATG9B cloning plasmid |
CSB-CL721119HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1233
- Sequence: ATGCCATCCTACCCTCAGCCCAGTGTGCTGAGAGGATCCGCTCCAGCCCGCTGCTGGTCCTCCTCCTGGTCCTGGCTGCCGGCTTCTGGCTGGTCCAACTGCTTCGCTCAGTCTGCAACCTCTTCAGCTACTGGGACATCCAGGTGTTTTACAGGGAGGCCCTGCACATCCCCCC
- Show more
|
Description: A cloning plasmid for the ATG9B gene. |
Rabbit Autophagy related protein 9B(ATG9B) ELISA kit |
E04A1752-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Autophagy related protein 9B(ATG9B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Autophagy related protein 9B(ATG9B) ELISA kit |
E04A1752-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Autophagy related protein 9B(ATG9B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Autophagy related protein 9B(ATG9B) ELISA kit |
E04A1752-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Autophagy related protein 9B(ATG9B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Autophagy Related Protein 9B (ATG9B) Antibody |
20-abx006484 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Autophagy Related Protein 9B (ATG9B) Antibody |
20-abx320322 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Autophagy Related Protein 9B (ATG9B) Antibody |
abx412187-01mg |
Abbexa |
0.1 mg |
EUR 537 |
|
Autophagy Related Protein 9B (ATG9B) Antibody |
abx448518-100ug |
Abbexa |
100 ug |
EUR 523 |
- Shipped within 5-12 working days.
|
Autophagy Related Protein 9B (ATG9B) Antibody |
20-abx225052 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Mouse ATG9B shRNA Plasmid |
20-abx980837 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human ATG9B shRNA Plasmid |
20-abx967140 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Autophagy Related Protein 9B (ATG9B) Antibody (ALP) |
abx447971-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Autophagy Related Protein 9B (ATG9B) Antibody (APC) |
abx447972-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Autophagy Related Protein 9B (ATG9B) Antibody (Biotin) |
abx447973-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Autophagy Related Protein 9B (ATG9B) Antibody (FITC) |
abx447974-100ug |
Abbexa |
100 ug |
EUR 565 |
- Shipped within 5-12 working days.
|
Autophagy Related Protein 9B (ATG9B) Antibody (HRP) |
abx447975-100ug |
Abbexa |
100 ug |
EUR 565 |
- Shipped within 5-12 working days.
|
Autophagy Related Protein 9B (ATG9B) Antibody (PerCP) |
abx447977-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Autophagy Related Protein 9B (ATG9B) Antibody (RPE) |
abx447978-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Autophagy Related Protein 9B (ATG9B) Antibody (Streptavidin) |
abx447979-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Atg9b ORF Vector (Mouse) (pORF) |
ORF039267 |
ABM |
1.0 ug DNA |
EUR 506 |
ATG9B ORF Vector (Human) (pORF) |
ORF012271 |
ABM |
1.0 ug DNA |
EUR 354 |
Atg9b ORF Vector (Rat) (pORF) |
ORF063781 |
ABM |
1.0 ug DNA |
EUR 506 |
Autophagy Related Protein 9B (ATG9B) Antibody (ATTO 390) |
abx447963-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Autophagy Related Protein 9B (ATG9B) Antibody (ATTO 488) |
abx447964-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Autophagy Related Protein 9B (ATG9B) Antibody (ATTO 565) |
abx447965-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Autophagy Related Protein 9B (ATG9B) Antibody (ATTO 594) |
abx447966-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Autophagy Related Protein 9B (ATG9B) Antibody (ATTO 633) |
abx447967-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Autophagy Related Protein 9B (ATG9B) Antibody (ATTO 655) |
abx447968-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Autophagy Related Protein 9B (ATG9B) Antibody (ATTO 680) |
abx447969-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
Autophagy Related Protein 9B (ATG9B) Antibody (ATTO 700) |
abx447970-100ug |
Abbexa |
100 ug |
EUR 578 |
- Shipped within 5-12 working days.
|
ATG9B sgRNA CRISPR Lentivector set (Human) |
K0142701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Atg9b sgRNA CRISPR Lentivector set (Mouse) |
K4690901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Atg9b sgRNA CRISPR Lentivector set (Rat) |
K6706201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Autophagy Related Protein 9B (ATG9B) Antibody (PE/ATTO 594) |
abx447976-100ug |
Abbexa |
100 ug |
EUR 592 |
- Shipped within 5-12 working days.
|
ATG9B sgRNA CRISPR Lentivector (Human) (Target 1) |
K0142702 |
ABM |
1.0 ug DNA |
EUR 154 |
ATG9B sgRNA CRISPR Lentivector (Human) (Target 2) |
K0142703 |
ABM |
1.0 ug DNA |
EUR 154 |
ATG9B sgRNA CRISPR Lentivector (Human) (Target 3) |
K0142704 |
ABM |
1.0 ug DNA |
EUR 154 |
Atg9b sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4690902 |
ABM |
1.0 ug DNA |
EUR 154 |
Atg9b sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4690903 |
ABM |
1.0 ug DNA |
EUR 154 |
Atg9b sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4690904 |
ABM |
1.0 ug DNA |
EUR 154 |
Atg9b sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6706202 |
ABM |
1.0 ug DNA |
EUR 154 |
Atg9b sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6706203 |
ABM |
1.0 ug DNA |
EUR 154 |
Atg9b sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6706204 |
ABM |
1.0 ug DNA |
EUR 154 |
ATG9B Protein Vector (Human) (pPB-C-His) |
PV049081 |
ABM |
500 ng |
EUR 481 |
ATG9B Protein Vector (Human) (pPB-N-His) |
PV049082 |
ABM |
500 ng |
EUR 481 |
ATG9B Protein Vector (Human) (pPM-C-HA) |
PV049083 |
ABM |
500 ng |
EUR 481 |
ATG9B Protein Vector (Human) (pPM-C-His) |
PV049084 |
ABM |
500 ng |
EUR 481 |
ATG9B Protein Vector (Human) (pPB-His-MBP) |
PV324814 |
ABM |
500 ng |
EUR 481 |
ATG9B Protein Vector (Human) (pPB-His-GST) |
PV324815 |
ABM |
500 ng |
EUR 481 |
ATG9B Protein Vector (Rat) (pPB-C-His) |
PV255122 |
ABM |
500 ng |
EUR 1166 |
ATG9B Protein Vector (Rat) (pPB-N-His) |
PV255123 |
ABM |
500 ng |
EUR 1166 |
ATG9B Protein Vector (Rat) (pPM-C-HA) |
PV255124 |
ABM |
500 ng |
EUR 1166 |
ATG9B Protein Vector (Rat) (pPM-C-His) |
PV255125 |
ABM |
500 ng |
EUR 1166 |
ATG9B Protein Vector (Mouse) (pPB-C-His) |
PV157066 |
ABM |
500 ng |
EUR 1065 |
ATG9B Protein Vector (Mouse) (pPB-N-His) |
PV157067 |
ABM |
500 ng |
EUR 1065 |
ATG9B Protein Vector (Mouse) (pPM-C-HA) |
PV157068 |
ABM |
500 ng |
EUR 1065 |
ATG9B Protein Vector (Mouse) (pPM-C-His) |
PV157069 |
ABM |
500 ng |
EUR 1065 |
Atg9b 3'UTR Luciferase Stable Cell Line |
TU201034 |
ABM |
1.0 ml |
Ask for price |
Atg9b 3'UTR GFP Stable Cell Line |
TU152277 |
ABM |
1.0 ml |
Ask for price |
ATG9B 3'UTR Luciferase Stable Cell Line |
TU001345 |
ABM |
1.0 ml |
EUR 2333 |
Atg9b 3'UTR Luciferase Stable Cell Line |
TU102277 |
ABM |
1.0 ml |
Ask for price |
ATG9B 3'UTR GFP Stable Cell Line |
TU051345 |
ABM |
1.0 ml |
EUR 2333 |
Atg9b 3'UTR GFP Stable Cell Line |
TU251034 |
ABM |
1.0 ml |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
MEK2 Rabbit Polyclonal Antibody |
ABP57573-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK2 Rabbit Polyclonal Antibody |
ABP57573-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK2 Rabbit Polyclonal Antibody |
ABP57573-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK3 Rabbit Polyclonal Antibody |
ABP57574-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of MEK3
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3 |
MEK3 Rabbit Polyclonal Antibody |
ABP57574-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of MEK3
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3 |
MEK3 Rabbit Polyclonal Antibody |
ABP57574-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of MEK3
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3 |
Nrf2 Rabbit Polyclonal Antibody |
ABP57575-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Nrf2
- Applications tips:
|
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2 |
Nrf2 Rabbit Polyclonal Antibody |
ABP57575-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Nrf2
- Applications tips:
|
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2 |
Nrf2 Rabbit Polyclonal Antibody |
ABP57575-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Nrf2
- Applications tips:
|
Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2 |
ATG4a Rabbit Polyclonal Antibody |
ABP57576-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATG4a
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a |
ATG4a Rabbit Polyclonal Antibody |
ABP57576-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATG4a
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a |
ATG4a Rabbit Polyclonal Antibody |
ABP57576-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATG4a
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a |
ATG4b Rabbit Polyclonal Antibody |
ABP57577-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATG4b
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b |
ATG4b Rabbit Polyclonal Antibody |
ABP57577-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATG4b
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b |
ATG4b Rabbit Polyclonal Antibody |
ABP57577-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATG4b
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b |
ATG4c Rabbit Polyclonal Antibody |
ABP57578-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATG4c
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c |
ATG4c Rabbit Polyclonal Antibody |
ABP57578-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATG4c
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c |
ATG4c Rabbit Polyclonal Antibody |
ABP57578-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATG4c
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c |
ATG5 Rabbit Polyclonal Antibody |
ABP57579-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATG5
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5 |
ATG5 Rabbit Polyclonal Antibody |
ABP57579-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATG5
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5 |
ATG5 Rabbit Polyclonal Antibody |
ABP57579-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATG5
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5 |
ATG7 Rabbit Polyclonal Antibody |
ABP57580-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATG7
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7 |
ATG7 Rabbit Polyclonal Antibody |
ABP57580-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATG7
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7 |
ATG7 Rabbit Polyclonal Antibody |
ABP57580-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATG7
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7 |
ATG13 Rabbit Polyclonal Antibody |
ABP57581-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATG13
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13 |
ATG13 Rabbit Polyclonal Antibody |
ABP57581-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATG13
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13 |
ATG13 Rabbit Polyclonal Antibody |
ABP57581-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATG13
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13 |
ATG13 Rabbit Polyclonal Antibody |
ABP57582-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATG13
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13 |
ATG13 Rabbit Polyclonal Antibody |
ABP57582-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATG13
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13 |
ATG13 Rabbit Polyclonal Antibody |
ABP57582-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATG13
- Applications tips:
|
Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13 |
ATG9B Rabbit Polyclonal Antibody