CCBE1 Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
CCBE1 Polyclonal Antibody |
ES10676-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CCBE1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
CCBE1 Polyclonal Antibody |
ABP58005-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human CCBE1 protein at amino acid sequence of 120-200
- Applications tips:
|
Description: A polyclonal antibody for detection of CCBE1 from Human. This CCBE1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCBE1 protein at amino acid sequence of 120-200 |
CCBE1 Polyclonal Antibody |
ABP58005-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human CCBE1 protein at amino acid sequence of 120-200
- Applications tips:
|
Description: A polyclonal antibody for detection of CCBE1 from Human. This CCBE1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCBE1 protein at amino acid sequence of 120-200 |
CCBE1 Polyclonal Antibody |
ABP58005-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human CCBE1 protein at amino acid sequence of 120-200
- Applications tips:
|
Description: A polyclonal antibody for detection of CCBE1 from Human. This CCBE1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCBE1 protein at amino acid sequence of 120-200 |
CCBE1 antibody |
70R-51193 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal CCBE1 antibody |
CCBE1 antibody |
70R-4000 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal CCBE1 antibody raised against the middle region of CCBE1 |
Ccbe1 antibody |
70R-9189 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal Ccbe1 antibody |
CCBE1 Antibody |
44510-100ul |
SAB |
100ul |
EUR 252 |
CCBE1 Antibody |
44510-50ul |
SAB |
50ul |
EUR 187 |
CCBE1 Antibody |
DF10092 |
Affbiotech |
200ul |
EUR 304 |
Description: CCBE1 Antibody detects endogenous levels of total CCBE1. |
Human Collagen and calcium-binding EGF domain-containing protein 1 (CCBE1) ELISA Kit |
DLR-CCBE1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Collagen and calcium-binding EGF domain-containing protein 1 (CCBE1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Collagen and calcium-binding EGF domain-containing protein 1 (CCBE1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Collagen and calcium-binding EGF domain-containing protein 1 (CCBE1) ELISA Kit |
DLR-CCBE1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Collagen and calcium-binding EGF domain-containing protein 1 (CCBE1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Collagen and calcium-binding EGF domain-containing protein 1 (CCBE1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Collagen and calcium-binding EGF domain-containing protein 1 (CCBE1) ELISA Kit |
RD-CCBE1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Collagen and calcium-binding EGF domain-containing protein 1 (CCBE1) ELISA Kit |
RD-CCBE1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Collagen and calcium-binding EGF domain-containing protein 1 (CCBE1) ELISA Kit |
RDR-CCBE1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Collagen and calcium-binding EGF domain-containing protein 1 (CCBE1) ELISA Kit |
RDR-CCBE1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Polyclonal Ccbe1 antibody - C-terminal region |
APR01142G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Ccbe1 - C-terminal region. This antibody is tested and proven to work in the following applications: |
CCBE1 Conjugated Antibody |
C44510 |
SAB |
100ul |
EUR 397 |
Anti-CCBE1 antibody |
STJ191834 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to CCBE1 |
CCBE1 siRNA |
20-abx910455 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CCBE1 siRNA |
20-abx910456 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-CCBE1 |
YF-PA22396 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to CCBE1 |
anti-CCBE1 |
YF-PA22397 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to CCBE1 |
anti-CCBE1 |
YF-PA22398 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to CCBE1 |
CCBE1 Blocking Peptide |
20-abx064068 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CCBE1 Blocking Peptide |
33R-7221 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CCBE1 antibody, catalog no. 70R-4000 |
Ccbe1 Blocking Peptide |
33R-7915 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Ccbe1 antibody, catalog no. 70R-9189 |
CCBE1 Blocking Peptide |
DF10092-BP |
Affbiotech |
1mg |
EUR 195 |
CCBE1 cloning plasmid |
CSB-CL747637HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 648
- Sequence: atggtgaaagccggaacttgctgtgccacatgcaaggagttctaccagatgaagcagaccgtgctgcagctgaagcaaaagattgctctgctccccaacaatgcagctgacctgggcaagtatatcactggtgacaaggtgctggcctcaaacacctaccttccaggacctcctgg
- Show more
|
Description: A cloning plasmid for the CCBE1 gene. |
Mouse CCBE1 shRNA Plasmid |
20-abx983470 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human CCBE1 shRNA Plasmid |
20-abx965517 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CCBE1 Recombinant Protein (Human) |
RP005782 |
ABM |
100 ug |
Ask for price |
CCBE1 Recombinant Protein (Mouse) |
RP121487 |
ABM |
100 ug |
Ask for price |
CCBE1 ORF Vector (Human) (pORF) |
ORF001928 |
ABM |
1.0 ug DNA |
EUR 95 |
Ccbe1 ORF Vector (Mouse) (pORF) |
ORF040497 |
ABM |
1.0 ug DNA |
EUR 506 |
CCBE1 sgRNA CRISPR Lentivector set (Human) |
K0372401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ccbe1 sgRNA CRISPR Lentivector set (Mouse) |
K4287001 |
ABM |
3 x 1.0 ug |
EUR 339 |
CCBE1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0372402 |
ABM |
1.0 ug DNA |
EUR 154 |
CCBE1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0372403 |
ABM |
1.0 ug DNA |
EUR 154 |
CCBE1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0372404 |
ABM |
1.0 ug DNA |
EUR 154 |
CCBE1 Rabbit Polyclonal Antibody