CCBE1 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

CCBE1 Polyclonal Antibody
ES10676-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CCBE1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
CCBE1 Polyclonal Antibody
ABP58005-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human CCBE1 protein at amino acid sequence of 120-200
  • Applications tips:
Description: A polyclonal antibody for detection of CCBE1 from Human. This CCBE1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCBE1 protein at amino acid sequence of 120-200
CCBE1 Polyclonal Antibody
ABP58005-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CCBE1 protein at amino acid sequence of 120-200
  • Applications tips:
Description: A polyclonal antibody for detection of CCBE1 from Human. This CCBE1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCBE1 protein at amino acid sequence of 120-200
CCBE1 Polyclonal Antibody
ABP58005-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CCBE1 protein at amino acid sequence of 120-200
  • Applications tips:
Description: A polyclonal antibody for detection of CCBE1 from Human. This CCBE1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCBE1 protein at amino acid sequence of 120-200
CCBE1 antibody
70R-51193 100 ul
EUR 244
Description: Purified Polyclonal CCBE1 antibody
CCBE1 antibody
70R-4000 50 ug
EUR 467
Description: Rabbit polyclonal CCBE1 antibody raised against the middle region of CCBE1
Ccbe1 antibody
70R-9189 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Ccbe1 antibody
CCBE1 Antibody
ABD10092 100 ug
EUR 438
CCBE1 Antibody
44510-100ul 100ul
EUR 252
CCBE1 Antibody
44510-50ul 50ul
EUR 187
CCBE1 Antibody
DF10092 200ul
EUR 304
Description: CCBE1 Antibody detects endogenous levels of total CCBE1.
Human Collagen and calcium-binding EGF domain-containing protein 1 (CCBE1) ELISA Kit
DLR-CCBE1-Hu-48T 48T
EUR 517
  • Should the Human Collagen and calcium-binding EGF domain-containing protein 1 (CCBE1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Collagen and calcium-binding EGF domain-containing protein 1 (CCBE1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Collagen and calcium-binding EGF domain-containing protein 1 (CCBE1) ELISA Kit
DLR-CCBE1-Hu-96T 96T
EUR 673
  • Should the Human Collagen and calcium-binding EGF domain-containing protein 1 (CCBE1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Collagen and calcium-binding EGF domain-containing protein 1 (CCBE1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
Human Collagen and calcium-binding EGF domain-containing protein 1 (CCBE1) ELISA Kit
RD-CCBE1-Hu-48Tests 48 Tests
EUR 521
Human Collagen and calcium-binding EGF domain-containing protein 1 (CCBE1) ELISA Kit
RD-CCBE1-Hu-96Tests 96 Tests
EUR 723
Human Collagen and calcium-binding EGF domain-containing protein 1 (CCBE1) ELISA Kit
RDR-CCBE1-Hu-48Tests 48 Tests
EUR 544
Human Collagen and calcium-binding EGF domain-containing protein 1 (CCBE1) ELISA Kit
RDR-CCBE1-Hu-96Tests 96 Tests
EUR 756
Polyclonal Ccbe1 antibody - C-terminal region
APR01142G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Ccbe1 - C-terminal region. This antibody is tested and proven to work in the following applications:
CCBE1 Conjugated Antibody
C44510 100ul
EUR 397
Anti-CCBE1 antibody
PAab01339 100 ug
EUR 355
Anti-CCBE1 antibody
STJ191834 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CCBE1
CCBE1 siRNA
20-abx910455
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CCBE1 siRNA
20-abx910456
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-CCBE1
YF-PA22396 50 ug
EUR 363
Description: Mouse polyclonal to CCBE1
anti-CCBE1
YF-PA22397 100 ul
EUR 403
Description: Rabbit polyclonal to CCBE1
anti-CCBE1
YF-PA22398 100 ug
EUR 403
Description: Rabbit polyclonal to CCBE1
CCBE1 Blocking Peptide
20-abx064068
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
CCBE1 Blocking Peptide
33R-7221 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CCBE1 antibody, catalog no. 70R-4000
Ccbe1 Blocking Peptide
33R-7915 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Ccbe1 antibody, catalog no. 70R-9189
CCBE1 Blocking Peptide
DF10092-BP 1mg
EUR 195
CCBE1 cloning plasmid
CSB-CL747637HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 648
  • Sequence: atggtgaaagccggaacttgctgtgccacatgcaaggagttctaccagatgaagcagaccgtgctgcagctgaagcaaaagattgctctgctccccaacaatgcagctgacctgggcaagtatatcactggtgacaaggtgctggcctcaaacacctaccttccaggacctcctgg
  • Show more
Description: A cloning plasmid for the CCBE1 gene.
Mouse CCBE1 shRNA Plasmid
20-abx983470
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human CCBE1 shRNA Plasmid
20-abx965517
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
CCBE1 ELISA KIT|Human
EF008431 96 Tests
EUR 689
Human CCBE1 ELISA KIT
ELI-33186h 96 Tests
EUR 824
Mouse Ccbe1 ELISA KIT
ELI-34268m 96 Tests
EUR 865
CCBE1 Recombinant Protein (Human)
RP005782 100 ug Ask for price
pCMV-SPORT6-CCBE1 Plasmid
PVT16889 2 ug
EUR 325
CCBE1 Recombinant Protein (Mouse)
RP121487 100 ug Ask for price
CCBE1 ORF Vector (Human) (pORF)
ORF001928 1.0 ug DNA
EUR 95
Ccbe1 ORF Vector (Mouse) (pORF)
ORF040497 1.0 ug DNA
EUR 506
CCBE1 sgRNA CRISPR Lentivector set (Human)
K0372401 3 x 1.0 ug
EUR 339
Ccbe1 sgRNA CRISPR Lentivector set (Mouse)
K4287001 3 x 1.0 ug
EUR 339
CCBE1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0372402 1.0 ug DNA
EUR 154
CCBE1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0372403 1.0 ug DNA
EUR 154
CCBE1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0372404 1.0 ug DNA
EUR 154

CCBE1 Rabbit Polyclonal Antibody