CENPJ Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

CENPJ Polyclonal Antibody
ES10523-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CENPJ from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
CENPJ Polyclonal Antibody
ABP58114-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human CENPJ protein at amino acid sequence of 510-590
  • Applications tips:
Description: A polyclonal antibody for detection of CENPJ from Human, Mouse. This CENPJ antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CENPJ protein at amino acid sequence of 510-590
CENPJ Polyclonal Antibody
ABP58114-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CENPJ protein at amino acid sequence of 510-590
  • Applications tips:
Description: A polyclonal antibody for detection of CENPJ from Human, Mouse. This CENPJ antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CENPJ protein at amino acid sequence of 510-590
CENPJ Polyclonal Antibody
ABP58114-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CENPJ protein at amino acid sequence of 510-590
  • Applications tips:
Description: A polyclonal antibody for detection of CENPJ from Human, Mouse. This CENPJ antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CENPJ protein at amino acid sequence of 510-590
CENPJ Polyclonal Antibody
A69435 100 ?g
EUR 628.55
Description: fast delivery possible
CENPJ Rabbit pAb
A8721-100ul 100 ul
EUR 308
CENPJ Rabbit pAb
A8721-200ul 200 ul
EUR 459
CENPJ Rabbit pAb
A8721-20ul 20 ul
EUR 183
CENPJ Rabbit pAb
A8721-50ul 50 ul
EUR 223
CENPJ Antibody
ABD2312 100 ug
EUR 438
CENPJ Antibody
36343-100ul 100ul
EUR 252
CENPJ antibody
70R-16351 50 ul
EUR 435
Description: Rabbit polyclonal CENPJ antibody
CENPJ Antibody
DF2312 200ul
EUR 304
Description: CENPJ antibody detects endogenous levels of total CENPJ.
CENPJ Antibody
1-CSB-PA005213GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CENPJ. Recognizes CENPJ from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF
CENPJ Antibody
1-CSB-PA005213LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CENPJ. Recognizes CENPJ from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:200-1:500
CENPJ Antibody
1-CSB-PA127200
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CENPJ. Recognizes CENPJ from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100
CENPJ Polyclonal Antibody, HRP Conjugated
A69436 100 ?g
EUR 628.55
Description: reagents widely cited
CENPJ Polyclonal Antibody, FITC Conjugated
A69437 100 ?g
EUR 628.55
Description: Ask the seller for details
CENPJ Polyclonal Antibody, Biotin Conjugated
A69438 100 ?g
EUR 628.55
Description: The best epigenetics products
CENPJ Conjugated Antibody
C36343 100ul
EUR 397
anti- CENPJ antibody
FNab01587 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:2000
  • IF: 1:10-1:100
  • Immunogen: centromere protein J
  • Uniprot ID: Q9HC77
  • Gene ID: 55835
  • Research Area: Developmental biology
Description: Antibody raised against CENPJ
Anti-CENPJ antibody
PAab01587 100 ug
EUR 355
Anti-CENPJ antibody
STJ113581 100 µl
EUR 277
Description: This gene encodes a protein that belongs to the centromere protein family. During cell division, this protein plays a structural role in the maintenance of centrosome integrity and normal spindle morphology, and it is involved in microtubule disassembly at the centrosome. This protein can function as a transcriptional coactivator in the Stat5 signaling pathway, and also as a coactivator of NF-kappaB-mediated transcription, likely via its interaction with the coactivator p300/CREB-binding protein. Mutations in this gene are associated with primary autosomal recessive microcephaly, a disorder characterized by severely reduced brain size and mental retardation. Alternatively spliced transcript variants have been found for this gene.
Anti-CENPJ antibody
STJ191681 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CENPJ
Centromere Protein J (CENPJ) Polyclonal Antibody (Human)
4-PAC263Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CENPJ (Met1~Asn207)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Centromere Protein J (CENPJ)
Centromere Protein J (CENPJ) Polyclonal Antibody (Mouse)
4-PAC263Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CENPJ (Met1~Asp204)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Centromere Protein J (CENPJ)
CENPJ siRNA
20-abx911455
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CENPJ siRNA
20-abx911456
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-CENPJ
YF-PA19875 50 ug
EUR 363
Description: Mouse polyclonal to CENPJ
anti-CENPJ
YF-PA19876 100 ul
EUR 403
Description: Rabbit polyclonal to CENPJ
anti-CENPJ
YF-PA19877 100 ug
EUR 403
Description: Rabbit polyclonal to CENPJ
anti-CENPJ
YF-PA26372 50 ul
EUR 334
Description: Mouse polyclonal to CENPJ
CENPJ Antibody, HRP conjugated
1-CSB-PA005213LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CENPJ. Recognizes CENPJ from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
CENPJ Antibody, FITC conjugated
1-CSB-PA005213LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CENPJ. Recognizes CENPJ from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
CENPJ Antibody, Biotin conjugated
1-CSB-PA005213LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CENPJ. Recognizes CENPJ from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Centromere Protein J (CENPJ) Polyclonal Antibody (Human), APC
4-PAC263Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CENPJ (Met1~Asn207)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Centromere Protein J (CENPJ). This antibody is labeled with APC.
Centromere Protein J (CENPJ) Polyclonal Antibody (Human), Biotinylated
4-PAC263Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CENPJ (Met1~Asn207)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Centromere Protein J (CENPJ). This antibody is labeled with Biotin.
Centromere Protein J (CENPJ) Polyclonal Antibody (Human), Cy3
4-PAC263Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CENPJ (Met1~Asn207)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Centromere Protein J (CENPJ). This antibody is labeled with Cy3.
Centromere Protein J (CENPJ) Polyclonal Antibody (Human), FITC
4-PAC263Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CENPJ (Met1~Asn207)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Centromere Protein J (CENPJ). This antibody is labeled with FITC.
Centromere Protein J (CENPJ) Polyclonal Antibody (Human), HRP
4-PAC263Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CENPJ (Met1~Asn207)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Centromere Protein J (CENPJ). This antibody is labeled with HRP.
Centromere Protein J (CENPJ) Polyclonal Antibody (Human), PE
4-PAC263Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CENPJ (Met1~Asn207)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Centromere Protein J (CENPJ). This antibody is labeled with PE.
Centromere Protein J (CENPJ) Polyclonal Antibody (Mouse), APC
4-PAC263Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CENPJ (Met1~Asp204)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Centromere Protein J (CENPJ). This antibody is labeled with APC.
Centromere Protein J (CENPJ) Polyclonal Antibody (Mouse), Biotinylated
4-PAC263Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CENPJ (Met1~Asp204)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Centromere Protein J (CENPJ). This antibody is labeled with Biotin.
Centromere Protein J (CENPJ) Polyclonal Antibody (Mouse), Cy3
4-PAC263Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CENPJ (Met1~Asp204)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Centromere Protein J (CENPJ). This antibody is labeled with Cy3.
Centromere Protein J (CENPJ) Polyclonal Antibody (Mouse), FITC
4-PAC263Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CENPJ (Met1~Asp204)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Centromere Protein J (CENPJ). This antibody is labeled with FITC.
Centromere Protein J (CENPJ) Polyclonal Antibody (Mouse), HRP
4-PAC263Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CENPJ (Met1~Asp204)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Centromere Protein J (CENPJ). This antibody is labeled with HRP.
Centromere Protein J (CENPJ) Polyclonal Antibody (Mouse), PE
4-PAC263Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CENPJ (Met1~Asp204)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Centromere Protein J (CENPJ). This antibody is labeled with PE.
Rabbit Centromere protein J(CENPJ) ELISA kit
E04C0930-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Centromere protein J(CENPJ) ELISA kit
E04C0930-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Centromere protein J(CENPJ) ELISA kit
E04C0930-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
CENPJ cloning plasmid
CSB-CL005213HU-10ug 10ug
EUR 1581
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 4017
  • Sequence: atgttcctgatgccaacctcttcagagttaaacagtgggcagaacttcctaacccagtggatgaccaatccttctcgggctggggtcatattaaatcgtggatttcctattttggaagcagacaaagagaagcgagcagctgtggacatttctaccagctttcctattaaaggca
  • Show more
Description: A cloning plasmid for the CENPJ gene.
CENPJ Blocking Peptide
DF2312-BP 1mg
EUR 195
Anti-CENPJ (5D5)
YF-MA18848 200 ul
EUR 363
Description: Mouse monoclonal to CENPJ
Anti-CENPJ (1A5)
YF-MA18849 50 ug
EUR 363
Description: Mouse monoclonal to CENPJ
Anti-CENPJ (1A5)
YF-MA18850 200 ul
EUR 363
Description: Mouse monoclonal to CENPJ
Anti-CENPJ (5D5)
YF-MA11574 100 ug
EUR 363
Description: Mouse monoclonal to CENPJ
Centromere Protein J (CENPJ) Antibody
20-abx124205
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Centromere Protein J (CENPJ) Antibody
20-abx111544
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Centromere Protein J (CENPJ) Antibody
20-abx131252
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Centromere Protein J (CENPJ) Antibody
20-abx131253
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Centromere Protein J (CENPJ) Antibody
20-abx338370
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Centromere Protein J (CENPJ) Antibody
20-abx211551
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Centromere Protein J (CENPJ) Antibody
abx231587-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Centromere Protein J (CENPJ) Polyclonal Antibody (Human), APC-Cy7
4-PAC263Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CENPJ (Met1~Asn207)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Centromere Protein J (CENPJ). This antibody is labeled with APC-Cy7.
Centromere Protein J (CENPJ) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC263Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CENPJ (Met1~Asp204)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Centromere Protein J (CENPJ). This antibody is labeled with APC-Cy7.
Centromere Protein J (CENPJ) Antibody (HRP)
20-abx335049
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Centromere Protein J (CENPJ) Antibody (FITC)
20-abx335050
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Centromere Protein J (CENPJ) Antibody (Biotin)
20-abx335051
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Mouse CENPJ shRNA Plasmid
20-abx981232
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human CENPJ shRNA Plasmid
20-abx960958
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Cenpj ORF Vector (Mouse) (pORF)
ORF041163 1.0 ug DNA
EUR 1572
CENPJ ORF Vector (Human) (pORF)
ORF012665 1.0 ug DNA
EUR 354
Cenpj ORF Vector (Rat) (pORF)
ORF064848 1.0 ug DNA
EUR 506
Recombinant Centromere Protein J (CENPJ)
4-RPC263Hu01
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9HC77
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Centromere Protein J expressed in: E.coli
Recombinant Centromere Protein J (CENPJ)
4-RPC263Mu01
  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q569L8
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): Inquire
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Centromere Protein J expressed in: E.coli
CENPJ ELISA Kit (Human) (OKWB00344)
OKWB00344 96 Wells
EUR 572
Description: Description of target: Plays an important role in cell division and centrosome function by participating in centriole duplication. Inhibits microtubule nucleation from the centrosome. Involved in the regulation of slow processive growth of centriolar microtubules. Acts as microtubule plus-end tracking protein that stabilizes centriolar microtubules and inhibits microtubule polymerization and extension from the distal ends of centrioles. Required for centriole elongation and for STIL-mediated centriole amplification. May be involved in the control of centriolar-microtubule growth by acting as a regulator of tubulin release.;Species reactivity: Human;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 0.469 ng/mL
CENPJ sgRNA CRISPR Lentivector set (Human)
K0432401 3 x 1.0 ug
EUR 339
Human Centromere Protein J (CENPJ) Protein
20-abx168856
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Mouse Centromere Protein J (CENPJ) Protein
20-abx168857
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Cenpj sgRNA CRISPR Lentivector set (Rat)
K6400901 3 x 1.0 ug
EUR 339
Cenpj sgRNA CRISPR Lentivector set (Mouse)
K4810801 3 x 1.0 ug
EUR 339
Goat Centromere protein J(CENPJ) ELISA kit
E06C0930-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Centromere protein J(CENPJ) ELISA kit
E06C0930-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Centromere protein J(CENPJ) ELISA kit
E06C0930-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Centromere protein J(CENPJ) ELISA kit
E02C0930-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Centromere protein J(CENPJ) ELISA kit
E02C0930-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Centromere protein J(CENPJ) ELISA kit
E02C0930-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Centromere protein J(CENPJ) ELISA kit
E03C0930-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Centromere protein J(CENPJ) ELISA kit
E03C0930-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Centromere protein J(CENPJ) ELISA kit
E03C0930-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Centromere protein J(CENPJ) ELISA kit
E01C0930-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Centromere protein J(CENPJ) ELISA kit
E01C0930-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Centromere protein J(CENPJ) ELISA kit
E01C0930-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Centromere protein J(CENPJ) ELISA kit
E07C0930-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Centromere protein J(CENPJ) ELISA kit
E07C0930-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Centromere protein J(CENPJ) ELISA kit
E07C0930-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Centromere protein J(CENPJ) ELISA kit
E08C0930-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Centromere protein J(CENPJ) ELISA kit
E08C0930-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Centromere protein J(CENPJ) ELISA kit
E08C0930-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Centromere protein J(CENPJ) ELISA kit
E09C0930-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Centromere protein J(CENPJ) ELISA kit
E09C0930-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Centromere protein J(CENPJ) ELISA kit
E09C0930-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Centromere protein J(CENPJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Centromere protein J, Cenpj ELISA KIT
ELI-11051m 96 Tests
EUR 865
Human Centromere protein J, CENPJ ELISA KIT
ELI-25720h 96 Tests
EUR 824
CENPJ sgRNA CRISPR Lentivector (Human) (Target 1)
K0432402 1.0 ug DNA
EUR 154
CENPJ sgRNA CRISPR Lentivector (Human) (Target 2)
K0432403 1.0 ug DNA
EUR 154
CENPJ sgRNA CRISPR Lentivector (Human) (Target 3)
K0432404 1.0 ug DNA
EUR 154
Cenpj sgRNA CRISPR Lentivector (Rat) (Target 1)
K6400902 1.0 ug DNA
EUR 154
Cenpj sgRNA CRISPR Lentivector (Rat) (Target 2)
K6400903 1.0 ug DNA
EUR 154
Cenpj sgRNA CRISPR Lentivector (Rat) (Target 3)
K6400904 1.0 ug DNA
EUR 154
Cenpj sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4810802 1.0 ug DNA
EUR 154
Cenpj sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4810803 1.0 ug DNA
EUR 154
Cenpj sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4810804 1.0 ug DNA
EUR 154
CENPJ Protein Vector (Human) (pPB-C-His)
PV050657 500 ng
EUR 481
CENPJ Protein Vector (Human) (pPB-N-His)
PV050658 500 ng
EUR 481
CENPJ Protein Vector (Human) (pPM-C-HA)
PV050659 500 ng
EUR 481
CENPJ Protein Vector (Human) (pPM-C-His)
PV050660 500 ng
EUR 481
CENPJ Protein Vector (Rat) (pPB-C-His)
PV259390 500 ng
EUR 1191
CENPJ Protein Vector (Rat) (pPB-N-His)
PV259391 500 ng
EUR 1191
CENPJ Protein Vector (Rat) (pPM-C-HA)
PV259392 500 ng
EUR 1191
CENPJ Protein Vector (Rat) (pPM-C-His)
PV259393 500 ng
EUR 1191
CENPJ Protein Vector (Mouse) (pPB-C-His)
PV164650 500 ng
EUR 2300
CENPJ Protein Vector (Mouse) (pPB-N-His)
PV164651 500 ng
EUR 2300
CENPJ Protein Vector (Mouse) (pPM-C-HA)
PV164652 500 ng
EUR 2300
CENPJ Protein Vector (Mouse) (pPM-C-His)
PV164653 500 ng
EUR 2300
Cenpj 3'UTR Luciferase Stable Cell Line
TU202174 1.0 ml Ask for price
Cenpj 3'UTR GFP Stable Cell Line
TU153718 1.0 ml Ask for price

CENPJ Rabbit Polyclonal Antibody