E2F8 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

E2F8 Polyclonal Antibody
ABP58447-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human E2F8 protein
  • Applications tips:
Description: A polyclonal antibody for detection of E2F8 from Human. This E2F8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human E2F8 protein
E2F8 Polyclonal Antibody
ABP58447-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human E2F8 protein
  • Applications tips:
Description: A polyclonal antibody for detection of E2F8 from Human. This E2F8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human E2F8 protein
E2F8 Polyclonal Antibody
ES10764-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against E2F8 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
E2F8 Polyclonal Antibody
ES10764-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against E2F8 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
E2F8 Rabbit pAb
A1135-100ul 100 ul
EUR 308
E2F8 Rabbit pAb
A1135-200ul 200 ul
EUR 459
E2F8 Rabbit pAb
A1135-20ul 20 ul
EUR 183
E2F8 Rabbit pAb
A1135-50ul 50 ul
EUR 223
E2F8 antibody
70R-16978 50 ul
EUR 435
Description: Rabbit polyclonal E2F8 antibody
E2F8 Antibody
32173-100ul 100ul
EUR 252
E2F8 Antibody
43312-100ul 100ul
EUR 252
E2F8 Antibody
DF6269 200ul
EUR 304
Description: E2F8 Antibody detects endogenous levels of total E2F8.
E2F8 Antibody
DF2591 200ul
EUR 304
Description: E2F8 antibody detects endogenous levels of total E2F8.
E2F8 antibody
70R-8752 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal E2F8 antibody
E2F8 Antibody
1-CSB-PA007349GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against E2F8. Recognizes E2F8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
E2F8 Antibody
ABD2591 100 ug
EUR 438
E2F8 Antibody
ABD6269 100 ug
EUR 438
Polyclonal E2F8 Antibody (C-Term)
APR07631G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human E2F8 (C-Term). This antibody is tested and proven to work in the following applications:
Polyclonal E2F8 Antibody (internal region)
APR07632G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human E2F8 (internal region). This antibody is tested and proven to work in the following applications:
Polyclonal E2F8 antibody - middle region
APR07634G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human E2F8 - middle region. This antibody is tested and proven to work in the following applications:
E2F8 Conjugated Antibody
C43312 100ul
EUR 397
E2F8 Conjugated Antibody
C32173 100ul
EUR 397
anti- E2F8 antibody
FNab02604 100µg
EUR 505.25
  • Immunogen: E2F transcription factor 8
  • Uniprot ID: A0AVK6
  • Gene ID: 79733
  • Research Area: Signal Transduction, Metabolism, Developmental biology
Description: Antibody raised against E2F8
Anti-E2F8 antibody
PAab02604 100 ug
EUR 355
Anti-E2F8 antibody
STJ23459 100 µl
EUR 277
Description: This gene encodes a member of a family of transcription factors which regulate the expression of genes required for progression through the cell cycle. The encoded protein regulates progression from G1 to S phase by ensuring the nucleus divides at the proper time. Multiple alternatively spliced variants, encoding the same protein, have been identified.
Anti-E2F8 antibody
STJ71792 100 µg
EUR 260
Anti-E2F8 antibody
STJ191922 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to E2F8
E2F8 siRNA
20-abx914863
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
E2F8 siRNA
20-abx914864
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Mouse Transcription factor E2F8, E2f8 ELISA KIT
ELI-09689m 96 Tests
EUR 865
Human Transcription factor E2F8, E2F8 ELISA KIT
ELI-47590h 96 Tests
EUR 824
E2F8 Blocking Peptide
33R-7652 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of E2F8 antibody, catalog no. 70R-8752
E2F8 Blocking Peptide
DF6269-BP 1mg
EUR 195
E2F8 Blocking Peptide
DF2591-BP 1mg
EUR 195
E2F8 cloning plasmid
CSB-CL007349HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1296
  • Sequence: atggctcagcttgcagctatttgtaaaatgcagttagaagagcaatcaagtgaatccagacagaaagtgaaagtacagctggcaagatctggaccctgcaaaccagtagcccctctggaccccccagtgaatgctgagatggagctgacagcaccgtccctcatccagcccctgg
  • Show more
Description: A cloning plasmid for the E2F8 gene.
E2F8 cloning plasmid
CSB-CL007349HU2-10ug 10ug
EUR 839
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2604
  • Sequence: atggagaacgaaaaggaaaatctcttttgtgagccacataaaaggggactaatgaaaacacctctgaaagaatccaccacagcaaatatcgtgttggcagagatccagcctgactttggccctttaaccacacctaccaagcccaaggaaggctctcagggagagccgtggacac
  • Show more
Description: A cloning plasmid for the E2F8 gene.
pCDNA3.1-E2F8-EGFP
PVT17525 2 ug
EUR 300
E2F8 ELISA KIT|Human
EF009270 96 Tests
EUR 689
Mouse E2F8 shRNA Plasmid
20-abx979955
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human E2F8 shRNA Plasmid
20-abx962522
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
pLVX-Puro-E2F8-EGFP
PVT17608 2 ug
EUR 300
Anti-E2F8 (3E9-2F5)
YF-MA11660 100 ug
EUR 363
Description: Mouse monoclonal to E2F8
E2F Transcription Factor 8 (E2F8) Antibody
20-abx112219
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
E2F Transcription Factor 8 (E2F8) Antibody
abx122347-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
E2F Transcription Factor 8 (E2F8) Antibody
abx145185-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
E2F Transcription Factor 8 (E2F8) Antibody
abx431042-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.
E2F Transcription Factor 8 (E2F8) Antibody
abx232604-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
E2F Transcription Factor 8 (E2F8) Antibody
20-abx001049
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Monoclonal E2F8 Antibody (monoclonal) (M01), Clone: S1
APR07633G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human E2F8 (monoclonal) (M01). The antibodies are raised in mouse and are from clone S1. This antibody is applicable in WB
E2F8 ORF Vector (Human) (pORF)
ORF003359 1.0 ug DNA
EUR 95
E2F8 ORF Vector (Human) (pORF)
ORF012896 1.0 ug DNA
EUR 354
E2f8 ORF Vector (Mouse) (pORF)
ORF043532 1.0 ug DNA
EUR 506
E2f8 sgRNA CRISPR Lentivector set (Mouse)
K4865001 3 x 1.0 ug
EUR 339
E2F8 sgRNA CRISPR Lentivector set (Human)
K0648801 3 x 1.0 ug
EUR 339
E2f8 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4865002 1.0 ug DNA
EUR 154
E2f8 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4865003 1.0 ug DNA
EUR 154
E2f8 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4865004 1.0 ug DNA
EUR 154
E2F8 sgRNA CRISPR Lentivector (Human) (Target 1)
K0648802 1.0 ug DNA
EUR 154
E2F8 sgRNA CRISPR Lentivector (Human) (Target 2)
K0648803 1.0 ug DNA
EUR 154
E2F8 sgRNA CRISPR Lentivector (Human) (Target 3)
K0648804 1.0 ug DNA
EUR 154
E2F8 Protein Vector (Mouse) (pPB-C-His)
PV174126 500 ng
EUR 1065
E2F8 Protein Vector (Mouse) (pPB-N-His)
PV174127 500 ng
EUR 1065
E2F8 Protein Vector (Mouse) (pPM-C-HA)
PV174128 500 ng
EUR 1065
E2F8 Protein Vector (Mouse) (pPM-C-His)
PV174129 500 ng
EUR 1065
E2F8 Protein Vector (Human) (pPB-C-His)
PV013433 500 ng
EUR 329
E2F8 Protein Vector (Human) (pPB-N-His)
PV013434 500 ng
EUR 329
E2F8 Protein Vector (Human) (pPM-C-HA)
PV013435 500 ng
EUR 329
E2F8 Protein Vector (Human) (pPM-C-His)
PV013436 500 ng
EUR 329
E2F8 Protein Vector (Human) (pPB-C-His)
PV051581 500 ng
EUR 481
E2F8 Protein Vector (Human) (pPB-N-His)
PV051582 500 ng
EUR 481
E2F8 Protein Vector (Human) (pPM-C-HA)
PV051583 500 ng
EUR 481
E2F8 Protein Vector (Human) (pPM-C-His)
PV051584 500 ng
EUR 481
E2f8 3'UTR GFP Stable Cell Line
TU155538 1.0 ml Ask for price
E2f8 3'UTR Luciferase Stable Cell Line
TU105538 1.0 ml Ask for price
E2f8 3'UTR Luciferase Stable Cell Line
TU203739 1.0 ml Ask for price
E2f8 3'UTR GFP Stable Cell Line
TU253739 1.0 ml Ask for price
E2F8 3'UTR GFP Stable Cell Line
TU056509 1.0 ml
EUR 1394
E2F8 3'UTR Luciferase Stable Cell Line
TU006509 1.0 ml
EUR 1394
Human E2F Transcription Factor 8 (E2F8) ELISA Kit
abx387031-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
E2F8 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV702057 1.0 ug DNA
EUR 450
E2F8 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV702061 1.0 ug DNA
EUR 450
E2F8 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV702062 1.0 ug DNA
EUR 450
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187
EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252
EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187
Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252
Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187
LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252
LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187
GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

E2F8 Rabbit Polyclonal Antibody