EMID2 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

EMID2 Polyclonal Antibody
ES10685-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against EMID2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
EMID2 Polyclonal Antibody
ABP58478-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human EMID2 protein at amino acid sequence of 120-200
  • Applications tips:
Description: A polyclonal antibody for detection of EMID2 from Human, Mouse. This EMID2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EMID2 protein at amino acid sequence of 120-200
EMID2 Polyclonal Antibody
ABP58478-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human EMID2 protein at amino acid sequence of 120-200
  • Applications tips:
Description: A polyclonal antibody for detection of EMID2 from Human, Mouse. This EMID2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EMID2 protein at amino acid sequence of 120-200
EMID2 Polyclonal Antibody
ABP58478-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human EMID2 protein at amino acid sequence of 120-200
  • Applications tips:
Description: A polyclonal antibody for detection of EMID2 from Human, Mouse. This EMID2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EMID2 protein at amino acid sequence of 120-200
EMID2 antibody
70R-7507 50 ug
EUR 467
Description: Rabbit polyclonal EMID2 antibody raised against the C terminal of EMID2
EMID2 antibody
70R-7529 50 ug
EUR 467
Description: Rabbit polyclonal EMID2 antibody raised against the C terminal of EMID2
EMID2 Antibody
ABD10102 100 ug
EUR 438
EMID2 Antibody
44513-100ul 100ul
EUR 252
EMID2 Antibody
44513-50ul 50ul
EUR 187
EMID2 Antibody
DF10102 200ul
EUR 304
Description: EMID2 Antibody detects endogenous levels of total EMID2.
EMID2 Conjugated Antibody
C44513 100ul
EUR 397
Anti-EMID2 antibody
STJ191843 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to EMID2
Rabbit Collagen alpha-1(EMID2) ELISA kit
E04C2285-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Collagen alpha-1(EMID2) ELISA kit
E04C2285-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Collagen alpha-1(EMID2) ELISA kit
E04C2285-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
EMID2 Blocking Peptide
33R-3653 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EMID2 antibody, catalog no. 70R-7529
EMID2 Blocking Peptide
33R-4766 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EMID2 antibody, catalog no. 70R-7507
EMID2 Blocking Peptide
DF10102-BP 1mg
EUR 195
EMID2 cloning plasmid
CSB-CL853381HU1-10ug 10ug
EUR 479
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1320
  • Sequence: ATGAAGCTGGCCCTGCTCCTGCCCTGGGCGTGTTGCTGCCTCTGCGGGTCGGCGCTGGCCACCGGCTTCCTCTATCCCTTCTCGGCCGCAGCTCTGCAGCAGCACGGCTACCCCGAGCCCGGCGCCGGCTCCCCTGGCAGCGGCTACGCGAGCCGCCGGCACTGGTGCCATCACA
  • Show more
Description: A cloning plasmid for the EMID2 gene.
EMID2 cloning plasmid
CSB-CL853381HU2-10ug 10ug
EUR 479
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1320
  • Sequence: ATGAAGCTGGCCCTGCTCCTGCCCTGGGCGTGTTGCTGCCTCTGCGGGTCGGCGCTGGCCACTGGCTTTCTCTATCCCTTCTCGGCCGCAGCTCTGCAGCAGCACGGCTACCCCGAGCCCGGCGCCGGCTCCCCTGGCAGCGGCTACGCGAGCCGCCGGCACTGGTGCCATCACA
  • Show more
Description: A cloning plasmid for the EMID2 gene.
anti-Anti-EMID2
YF-PA26883 50 ul
EUR 334
Description: Mouse polyclonal to Anti-EMID2
EMID2 Recombinant Protein (Human)
RP038746 100 ug Ask for price
EMID2 Recombinant Protein (Human)
RP038749 100 ug Ask for price
EMID2 Recombinant Protein (Mouse)
RP131624 100 ug Ask for price
EMI Domain-Containing Protein 2 (EMID2) Antibody
abx029671-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
EMI Domain-Containing Protein 2 (EMID2) Antibody
abx029671-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
EMI Domain-Containing Protein 2 (EMID2) Antibody
20-abx215146
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Emid2 ORF Vector (Mouse) (pORF)
ORF043876 1.0 ug DNA
EUR 506
EMID2 ORF Vector (Human) (pORF)
ORF012916 1.0 ug DNA
EUR 354
EMID2 ORF Vector (Human) (pORF)
ORF012917 1.0 ug DNA
EUR 354
EMID2 sgRNA CRISPR Lentivector set (Human)
K0678001 3 x 1.0 ug
EUR 339
Emid2 sgRNA CRISPR Lentivector set (Mouse)
K4043201 3 x 1.0 ug
EUR 339
Goat Collagen alpha-1(EMID2) ELISA kit
E06C2285-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Collagen alpha-1(EMID2) ELISA kit
E06C2285-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Collagen alpha-1(EMID2) ELISA kit
E06C2285-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Collagen alpha-1(EMID2) ELISA kit
E01C2285-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Collagen alpha-1(EMID2) ELISA kit
E01C2285-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Collagen alpha-1(EMID2) ELISA kit
E01C2285-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Collagen alpha-1(EMID2) ELISA kit
E02C2285-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Collagen alpha-1(EMID2) ELISA kit
E02C2285-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Collagen alpha-1(EMID2) ELISA kit
E02C2285-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Collagen alpha-1(EMID2) ELISA kit
E03C2285-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Collagen alpha-1(EMID2) ELISA kit
E03C2285-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Collagen alpha-1(EMID2) ELISA kit
E03C2285-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Collagen alpha-1(EMID2) ELISA kit
E08C2285-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Collagen alpha-1(EMID2) ELISA kit
E08C2285-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Collagen alpha-1(EMID2) ELISA kit
E08C2285-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Collagen alpha-1(EMID2) ELISA kit
E09C2285-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Collagen alpha-1(EMID2) ELISA kit
E09C2285-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Collagen alpha-1(EMID2) ELISA kit
E09C2285-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Collagen alpha-1(EMID2) ELISA kit
E07C2285-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Collagen alpha-1(EMID2) ELISA kit
E07C2285-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Collagen alpha-1(EMID2) ELISA kit
E07C2285-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Collagen alpha-1(EMID2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
EMID2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0678002 1.0 ug DNA
EUR 154
EMID2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0678003 1.0 ug DNA
EUR 154

EMID2 Rabbit Polyclonal Antibody