GRIP1 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

GRIP1 Polyclonal Antibody
ES10692-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GRIP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GRIP1 Polyclonal Antibody
ES10692-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GRIP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

GRIP1 Rabbit pAb
A5747-100ul 100 ul
EUR 308

GRIP1 Rabbit pAb
A5747-200ul 200 ul
EUR 459

GRIP1 Rabbit pAb
A5747-20ul 20 ul
EUR 183

GRIP1 Rabbit pAb
A5747-50ul 50 ul
EUR 223

GRIP1 Rabbit pAb
A16503-100ul 100 ul
EUR 308

GRIP1 Rabbit pAb
A16503-200ul 200 ul
EUR 459

GRIP1 Rabbit pAb
A16503-20ul 20 ul
EUR 183

GRIP1 Rabbit pAb
A16503-50ul 50 ul
EUR 223

Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
DLR-GRIP1-Hu-48T 48T
EUR 498
  • Should the Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutamate Receptor Interacting Protein 1 (GRIP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
DLR-GRIP1-Hu-96T 96T
EUR 647
  • Should the Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutamate Receptor Interacting Protein 1 (GRIP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
RDR-GRIP1-Hu-48Tests 48 Tests
EUR 522

Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
RDR-GRIP1-Hu-96Tests 96 Tests
EUR 724

Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
RD-GRIP1-Hu-48Tests 48 Tests
EUR 500

Human Glutamate Receptor Interacting Protein 1 (GRIP1) ELISA Kit
RD-GRIP1-Hu-96Tests 96 Tests
EUR 692

GRIP1 antibody
20R-1077 100 ug
EUR 377
Description: Rabbit polyclonal GRIP1 antibody

GRIP1 Antibody
44803-100ul 100ul
EUR 252

GRIP1 Antibody
44803-50ul 50ul
EUR 187

GRIP1 Antibody
DF2500 200ul
EUR 304
Description: GRIP1 antibody detects endogenous levels of total GRIP1.

GRIP1 antibody
70R-7931 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal GRIP1 antibody

GRIP1 Antibody
ABD2500 100 ug
EUR 438

Polyclonal GRIP1 antibody - C-terminal region
APR12279G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GRIP1 - C-terminal region. This antibody is tested and proven to work in the following applications:

GRIP1 Conjugated Antibody
C44803 100ul
EUR 397

anti- GRIP1 antibody
FNab03650 100µg
EUR 548.75
  • Immunogen: glutamate receptor interacting protein 1
  • Uniprot ID: Q9Y3R0
  • Gene ID: 23426
  • Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against GRIP1

Anti-GRIP1 antibody
PAab03650 100 ug
EUR 386

Anti-GRIP1 antibody
STJ28314 100 µl
EUR 277
Description: This gene encodes a member of the glutamate receptor interacting protein family. The encoded scaffold protein binds to and mediates the trafficking and membrane organization of a number of transmembrane proteins. Alternatively spliced transcript variants encoding different isoforms have been described.

Anti-GRIP1 antibody
STJ118942 100 µl
EUR 277

Anti-GRIP1 antibody
STJ191850 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GRIP1

Grip1/ Rat Grip1 ELISA Kit
ELI-42869r 96 Tests
EUR 886

GRIP1 siRNA
20-abx902326
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GRIP1 siRNA
20-abx918710
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GRIP1 siRNA
20-abx918711
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-GRIP1
YF-PA25886 50 ul
EUR 334
Description: Mouse polyclonal to GRIP1

GRIP1 Blocking Peptide
33R-8113 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GRIP1 antibody, catalog no. 70R-7931

GRIP1 Blocking Peptide
33R-6108 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GRIP1 antibody, catalog no. 20R-1077

GRIP1 cloning plasmid
CSB-CL897486HU-10ug 10ug
EUR 1154
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3231
  • Sequence: ATGATAGCTGTCTCTTTTAAATGCCGTTGTCAAATTCTGAGGCGACTTACTAAAGATGAGAGTCCCTACACTAAATCCGCCAGCCAGACAAAGCCGCCTGATGGAGCGTTGGCTGTGAGGAGACAGAGCATCCCAGAGGAATTCAAGGGCTCCACAGTCGTCGAGCTGATGAAGA
  • Show more
Description: A cloning plasmid for the GRIP1 gene.

GRIP1 Blocking Peptide
DF2500-BP 1mg
EUR 195

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human)
4-PAB753Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIP1 (Gly874~Glu1073)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1)

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human)
4-PAB753Hu02
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIP1 (Arg79~Thr268)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1)

GRIP1-Associated Protein 1 (GRASP1) Antibody
20-abx112850
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

GRIP1-Associated Protein 1 (GRASP1) Antibody
20-abx125907
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

GRIP1-Associated Protein 1 (GRASP1) Antibody
abx233651-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

GRIP1-Associated Protein 1 (GRIPAP1) Antibody
abx332123-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

GRIP1-Associated Protein 1 (GRASP1) Antibody
abx430720-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), APC
4-PAB753Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIP1 (Gly874~Glu1073)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with APC.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), Biotinylated
4-PAB753Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIP1 (Gly874~Glu1073)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with Biotin.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), Cy3
4-PAB753Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIP1 (Gly874~Glu1073)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with Cy3.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), FITC
4-PAB753Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIP1 (Gly874~Glu1073)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with FITC.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), HRP
4-PAB753Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIP1 (Gly874~Glu1073)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with HRP.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), PE
4-PAB753Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIP1 (Gly874~Glu1073)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with PE.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), APC
4-PAB753Hu02-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIP1 (Arg79~Thr268)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with APC.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), Biotinylated
4-PAB753Hu02-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIP1 (Arg79~Thr268)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with Biotin.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), Cy3
4-PAB753Hu02-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIP1 (Arg79~Thr268)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with Cy3.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), FITC
4-PAB753Hu02-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIP1 (Arg79~Thr268)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with FITC.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), HRP
4-PAB753Hu02-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIP1 (Arg79~Thr268)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with HRP.

Glutamate Receptor Interacting Protein 1 (GRIP1) Polyclonal Antibody (Human), PE
4-PAB753Hu02-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GRIP1 (Arg79~Thr268)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glutamate Receptor Interacting Protein 1 (GRIP1). This antibody is labeled with PE.

GRIP1 ELISA KIT|Human
EF009995 96 Tests
EUR 689

Mouse GRIP1 shRNA Plasmid
20-abx978072
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat GRIP1 shRNA Plasmid
20-abx986893
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GRIP1 shRNA Plasmid
20-abx958262
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rabbit Glutamate receptor interacting protein 1(GRIP1) ELISA kit
E04G0400-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Glutamate receptor interacting protein 1(GRIP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

GRIP1 Rabbit Polyclonal Antibody