HES2 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

HES2 Polyclonal Antibody

ES10672-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HES2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

HES2 Antibody

45350-100ul 100ul
EUR 252

HES2 Antibody

45350-50ul 50ul
EUR 187

HES2 Antibody

1-CSB-PA897496LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HES2. Recognizes HES2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

HES2 Antibody

DF8555 200ul
EUR 304
Description: HES2 Antibody detects endogenous levels of total HES2.

HES2 antibody

70R-51013 100 ul
EUR 244
Description: Purified Polyclonal HES2 antibody

HES2 Antibody

ABD8555 100 ug
EUR 438

Hes2/ Rat Hes2 ELISA Kit

ELI-30892r 96 Tests
EUR 886

Anti-HES2 Antibody

A12879 100ul
EUR 397
Description: Rabbit Polyclonal HES2 Antibody. Validated in WB and tested in Human, Mouse, Rat.

HES2 Conjugated Antibody

C45350 100ul
EUR 397

Anti-HES2 antibody

STJ191830 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to HES2

HES2 siRNA

20-abx902448
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HES2 siRNA

20-abx919282
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HES2 siRNA

20-abx919283
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HES2 Antibody, HRP conjugated

1-CSB-PA897496LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HES2. Recognizes HES2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HES2 Antibody, FITC conjugated

1-CSB-PA897496LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HES2. Recognizes HES2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HES2 Antibody, Biotin conjugated

1-CSB-PA897496LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HES2. Recognizes HES2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

HES2 cloning plasmid

CSB-CL897496HU-10ug 10ug
EUR 185
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 231
  • Sequence: atggggctgcctcgccgggcaggggacgcggcggagctgcgcaagagcctgaagccgctgctggagaagcgccggcgcgcgcgcatcaaccagagcctgagccagcttaaggggctcatcctgccgctgctgggccgggaggatgcttctggctggcacacctggcttcccctcca
  • Show more
Description: A cloning plasmid for the HES2 gene.

HES2 Blocking Peptide

DF8555-BP 1mg
EUR 195

HES2 Blocking Peptide

20-abx063888
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Anti-HES2 (4H6)

YF-MA18669 100 ug
EUR 363
Description: Mouse monoclonal to HES2

Anti-HES2 (3H1)

YF-MA18670 100 ug
EUR 363
Description: Mouse monoclonal to HES2

Anti-HES2 (2G6)

YF-MA18671 100 ug
EUR 363
Description: Mouse monoclonal to HES2

Anti-HES2 (1B12)

YF-MA18672 100 ug
EUR 363
Description: Mouse monoclonal to HES2

Anti-HES2 (4A5)

YF-MA18673 100 ug
EUR 363
Description: Mouse monoclonal to HES2

Anti-HES2 (2F4)

YF-MA18674 100 ug
EUR 363
Description: Mouse monoclonal to HES2

Anti-HES2 (3C2)

YF-MA18675 100 ug
EUR 363
Description: Mouse monoclonal to HES2

Anti-HES2 (1D8)

YF-MA18676 100 ug
EUR 363
Description: Mouse monoclonal to HES2

Anti-HES2 (3B3)

YF-MA18677 100 ug
EUR 363
Description: Mouse monoclonal to HES2

Anti-HES2 (1D5)

YF-MA18678 100 ug
EUR 363
Description: Mouse monoclonal to HES2

HES2 protein (His tag)

80R-2966 50 ug
EUR 327
Description: Purified recombinant IMPACT protein (His tag)

Rat HES2 shRNA Plasmid

20-abx985591
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human HES2 shRNA Plasmid

20-abx960160
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse HES2 shRNA Plasmid

20-abx970780
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-SPORT6-HES2 Plasmid

PVT17011 2 ug
EUR 325

HES2 Recombinant Protein (Human)

RP014587 100 ug Ask for price

HES2 Recombinant Protein (Rat)

RP204458 100 ug Ask for price

HES2 Recombinant Protein (Mouse)

RP141332 100 ug Ask for price

Transcription Factor HES-2 (HES2) Antibody

20-abx008125
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Transcription Factor HES-2 (HES2) Antibody

20-abx215860
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hes2 ORF Vector (Rat) (pORF)

ORF068154 1.0 ug DNA
EUR 506

HES2 ORF Vector (Human) (pORF)

ORF004863 1.0 ug DNA
EUR 95

HES2 Rabbit Polyclonal Antibody