IFI6 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

IFI6 Polyclonal Antibody
ES10713-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IFI6 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
IFI6 Polyclonal Antibody
ABP58877-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human IFI6 protein
  • Applications tips:
Description: A polyclonal antibody for detection of IFI6 from Human. This IFI6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IFI6 protein
IFI6 Polyclonal Antibody
ABP58877-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human IFI6 protein
  • Applications tips:
Description: A polyclonal antibody for detection of IFI6 from Human. This IFI6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IFI6 protein
IFI6 Polyclonal Antibody
ABP58877-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human IFI6 protein
  • Applications tips:
Description: A polyclonal antibody for detection of IFI6 from Human. This IFI6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IFI6 protein
IFI6 Rabbit pAb
A6157-100ul 100 ul
EUR 308
IFI6 Rabbit pAb
A6157-200ul 200 ul
EUR 459
IFI6 Rabbit pAb
A6157-20ul 20 ul
EUR 183
IFI6 Rabbit pAb
A6157-50ul 50 ul
EUR 223
IFI6 Antibody
ABD10115 100 ug
EUR 438
IFI6 Antibody
35228-100ul 100ul
EUR 252
IFI6 Antibody
35228-50ul 50ul
EUR 187
IFI6 antibody
38739-100ul 100ul
EUR 252
IFI6 Antibody
DF10115 200ul
EUR 304
Description: IFI6 Antibody detects endogenous levels of total IFI6.
IFI6 Antibody
CSB-PA253751-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against IFI6. Recognizes IFI6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
IFI6 Antibody
CSB-PA253751-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against IFI6. Recognizes IFI6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
Polyclonal IFI6 Antibody (N-term)
APR07950G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IFI6 (N-term). This antibody is tested and proven to work in the following applications:
IFI6 Conjugated Antibody
C38739 100ul
EUR 397
Anti-IFI6 Antibody
A08687 100ul
EUR 397
Description: Rabbit Polyclonal IFI6 Antibody. Validated in WB and tested in Human.
Anti-IFI6 antibody
STJ27910 100 µl
EUR 277
Description: This gene was first identified as one of the many genes induced by interferon. The encoded protein may play a critical role in the regulation of apoptosis. A minisatellite that consists of 26 repeats of a 12 nucleotide repeating element resembling the mammalian splice donor consensus sequence begins near the end of the second exon. Alternatively spliced transcript variants that encode different isoforms by using the two downstream repeat units as splice donor sites have been described.
Anti-IFI6 antibody
STJ191871 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to IFI6
IFI6 siRNA
20-abx920192
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
IFI6 cloning plasmid
CSB-CL011016HU-10ug 10ug
EUR 220
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 393
  • Sequence: atgcggcagaaggcggtatcgcttttcttgtgctacctgctgctcttcacttgcagtggggtggaggcaggtaagaaaaagtgctcggagagctcggacagcggctccgggttctggaaggccctgaccttcatggccgtcggaggaggactcgcagtcgccgggctgcccgcgct
  • Show more
Description: A cloning plasmid for the IFI6 gene.
IFI6 Blocking Peptide
DF10115-BP 1mg
EUR 195
Human IFI6 ELISA Kit
ELA-E11193h 96 Tests
EUR 824
IFI6 ELISA KIT|Human
EF003337 96 Tests
EUR 689
Human IFI6 shRNA Plasmid
20-abx951681
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
IFI6 Recombinant Protein (Human)
RP015604 100 ug Ask for price
IFI6 ORF Vector (Human) (pORF)
ORF005202 1.0 ug DNA
EUR 95
IFI6 ELISA Kit (Human) (OKEH02144)
OKEH02144 96 Wells
EUR 662
Description: Description of target: This gene was first identified as one of the many genes induced by interferon. The encoded protein may play a critical role in the regulation of apoptosis. A minisatellite that consists of 26 repeats of a 12 nucleotide repeating element resembling the mammalian splice donor consensus sequence begins near the end of the second exon. Alternatively spliced transcript variants that encode different isoforms by using the two downstream repeat units as splice donor sites have been described.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7.9 pg/mL
IFI6 ELISA Kit (Bovine) (OKEH07705)
OKEH07705 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:
Interferon Alpha Inducible Protein 6 (IFI6) Antibody
20-abx004709
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Interferon Alpha Inducible Protein 6 (IFI6) Antibody
20-abx015094
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
Interferon Alpha Inducible Protein 6 (IFI6) Antibody
abx330737-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
Interferon Alpha Inducible Protein 6 (IFI6) Antibody
20-abx225231
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
IFI6 sgRNA CRISPR Lentivector set (Human)
K1016501 3 x 1.0 ug
EUR 339
IFI6 sgRNA CRISPR Lentivector (Human) (Target 1)
K1016502 1.0 ug DNA
EUR 154
IFI6 sgRNA CRISPR Lentivector (Human) (Target 2)
K1016503 1.0 ug DNA
EUR 154
IFI6 sgRNA CRISPR Lentivector (Human) (Target 3)
K1016504 1.0 ug DNA
EUR 154
Human Interferon alpha-inducible protein 6 (IFI6)
1-CSB-YP011016HU
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 12.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Interferon alpha-inducible protein 6(IFI6) expressed in Yeast
Human Interferon alpha-inducible protein 6 (IFI6)
1-CSB-EP011016HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 24.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Interferon alpha-inducible protein 6(IFI6) expressed in E.coli
IFI6 Protein Vector (Human) (pPB-C-His)
PV020805 500 ng
EUR 329
IFI6 Protein Vector (Human) (pPB-N-His)
PV020806 500 ng
EUR 329
IFI6 Protein Vector (Human) (pPM-C-HA)
PV020807 500 ng
EUR 329
IFI6 Protein Vector (Human) (pPM-C-His)
PV020808 500 ng
EUR 329
IFI6 3'UTR Luciferase Stable Cell Line
TU010442 1.0 ml
EUR 1394
IFI6 3'UTR GFP Stable Cell Line
TU060442 1.0 ml
EUR 1394
Cow Interferon Alpha Inducible Protein 6 (IFI6) ELISA Kit
abx515294-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human IFI6/ Interferon alpha-inducible protein 6 ELISA Kit
E1214Hu 1 Kit
EUR 605
Human IFI6(Interferon alpha-inducible protein 6) ELISA Kit
EH1270 96T
EUR 567.6
  • Detection range: 31.2-2000 pg/ml
  • Uniprot ID: P09912
  • Alias: IFI6/Interferon alpha-inducible protein 6/Interferon-induced protein 6-16(Ifi-6-16)/G1P3/FAM14C/IFI-6-16/6-16/IFI616
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml
Human Interferon alpha- inducible protein 6, IFI6 ELISA KIT
ELI-03678h 96 Tests
EUR 824
Bovine Interferon alpha- inducible protein 6, IFI6 ELISA KIT
ELI-03679b 96 Tests
EUR 928
Human Interferon Alpha Inducible Protein 6 (IFI6) ELISA Kit
abx250532-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IFI6 Rabbit Polyclonal Antibody