LRRK2 Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

LRRK2 Polyclonal Antibody

ABP59149-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human LRRK2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of LRRK2 from Human, Mouse. This LRRK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LRRK2 protein

LRRK2 Polyclonal Antibody

ABP59149-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human LRRK2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of LRRK2 from Human, Mouse. This LRRK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LRRK2 protein

LRRK2 Polyclonal Antibody

ES10815-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against LRRK2 from Human/Mouse. This antibody is tested and validated for IHC

LRRK2 Polyclonal Antibody

ES10815-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against LRRK2 from Human/Mouse. This antibody is tested and validated for IHC

LRRK2 Rabbit pAb

A0859-100ul 100 ul
EUR 308

LRRK2 Rabbit pAb

A0859-200ul 200 ul
EUR 459

LRRK2 Rabbit pAb

A0859-20ul 20 ul
EUR 183

LRRK2 Rabbit pAb

A0859-50ul 50 ul
EUR 223

LRRK2 Rabbit pAb

A10959-100ul 100 ul
EUR 308

LRRK2 Rabbit pAb

A10959-200ul 200 ul
EUR 459

LRRK2 Rabbit pAb

A10959-20ul 20 ul Ask for price

LRRK2 Rabbit pAb

A10959-50ul 50 ul Ask for price

LRRK2 Rabbit pAb

A17253-100ul 100 ul
EUR 308

LRRK2 Rabbit pAb

A17253-200ul 200 ul
EUR 459

LRRK2 Rabbit pAb

A17253-20ul 20 ul
EUR 183

LRRK2 Rabbit pAb

A17253-50ul 50 ul
EUR 223

Human Leucine Rich Repeat Kinase 2 (LRRK2) ELISA Kit

DLR-LRRK2-Hu-48T 48T
EUR 517
  • Should the Human Leucine Rich Repeat Kinase 2 (LRRK2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Leucine Rich Repeat Kinase 2 (LRRK2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Leucine Rich Repeat Kinase 2 (LRRK2) ELISA Kit

DLR-LRRK2-Hu-96T 96T
EUR 673
  • Should the Human Leucine Rich Repeat Kinase 2 (LRRK2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Leucine Rich Repeat Kinase 2 (LRRK2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Leucine Rich Repeat Kinase 2 (LRRK2) ELISA Kit

RDR-LRRK2-Hu-48Tests 48 Tests
EUR 544

Human Leucine Rich Repeat Kinase 2 (LRRK2) ELISA Kit

RDR-LRRK2-Hu-96Tests 96 Tests
EUR 756

Human Leucine Rich Repeat Kinase 2 (LRRK2) ELISA Kit

RD-LRRK2-Hu-48Tests 48 Tests
EUR 521

Human Leucine Rich Repeat Kinase 2 (LRRK2) ELISA Kit

RD-LRRK2-Hu-96Tests 96 Tests
EUR 723

Anti-LRRK2 Rabbit Monoclonal Antibody

M00221 100ug/vial
EUR 397
Description: Rabbit Monoclonal LRRK2 Antibody. Validated in IP, IF, IHC, ICC, WB and tested in Human, Mouse, Rat.

Anti-LRRK2 Rabbit Monoclonal Antibody

M00221-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal LRRK2 Antibody. Validated in IF, WB and tested in Human, Mouse.

Anti-LRRK2 Rabbit Monoclonal Antibody

M00221-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal LRRK2 Antibody. Validated in IP, IF, IHC, WB and tested in Human, Mouse, Rat.

Polyclonal PARK8 (LRRK2) Antibody (L955)

APG03034G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PARK8 (LRRK2) (L955). This antibody is tested and proven to work in the following applications:

Polyclonal PARK8 (LRRK2) Antibody (E519)

APR11282G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PARK8 (LRRK2) (E519). This antibody is tested and proven to work in the following applications:

Polyclonal PARK8 (LRRK2) Antibody (L893)

APR11283G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PARK8 (LRRK2) (L893). This antibody is tested and proven to work in the following applications:

Polyclonal PARK8 (LRRK2) Antibody (L899)

APR11284G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PARK8 (LRRK2) (L899). This antibody is tested and proven to work in the following applications:

Polyclonal LRRK2 Antibody (C-Terminus)

APR12471G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human LRRK2 (C-Terminus). This antibody is tested and proven to work in the following applications:

LRRK2 Antibody

35803-100ul 100ul
EUR 252

LRRK2 Antibody

1-CSB-PA902150
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LRRK2. Recognizes LRRK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

LRRK2 Antibody

1-CSB-PA722493LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LRRK2. Recognizes LRRK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

LRRK2 Antibody

DF2668 200ul
EUR 304
Description: LRRK2 antibody detects endogenous levels of total LRRK2.

LRRK2 Antibody

1-CSB-PA444926
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LRRK2. Recognizes LRRK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

LRRK2 Antibody

ABD2668 100 ug
EUR 438

LRRK2 Conjugated Antibody

C35803 100ul
EUR 397

Anti-LRRK2 Antibody

PB9281 100ug/vial
EUR 294

Anti-LRRK2 antibody

STJ112849 100 µl
EUR 277
Description: This gene is a member of the leucine-rich repeat kinase family and encodes a protein with an ankryin repeat region, a leucine-rich repeat (LRR) domain, a kinase domain, a DFG-like motif, a RAS domain, a GTPase domain, a MLK-like domain, and a WD40 domain. The protein is present largely in the cytoplasm but also associates with the mitochondrial outer membrane. Mutations in this gene have been associated with Parkinson disease-8.

Anti-LRRK2 antibody

STJ117999 100 µl
EUR 277

Anti-LRRK2 antibody

STJ119412 100 µl
EUR 277

Anti-LRRK2 antibody

STJ191973 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to LRRK2

Anti-Phospho-LRRK2 (S935) Rabbit Monoclonal Antibody

P00221 100ug/vial
EUR 397
Description: Rabbit Monoclonal Phospho-LRRK2 (S935) Antibody. Validated in IF, WB and tested in Human, Mouse.

anti-LRRK2

YF-PA26847 50 ul
EUR 334
Description: Mouse polyclonal to LRRK2

LRRK2 Antibody, HRP conjugated

1-CSB-PA722493LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LRRK2. Recognizes LRRK2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LRRK2 Antibody, FITC conjugated

1-CSB-PA722493LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LRRK2. Recognizes LRRK2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LRRK2 Antibody, Biotin conjugated

1-CSB-PA722493LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LRRK2. Recognizes LRRK2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Monoclonal antibody for LRRK2/Dardarin

SMC-445D 0.1mg
EUR 353
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is not conjugated.

Monoclonal antibody for LRRK2/Dardarin

SMC-445D-A390 0.1mg
EUR 400
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with ATTO 390.

Monoclonal antibody for LRRK2/Dardarin

SMC-445D-A488 0.1mg
EUR 399
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with ATTO 488.

Monoclonal antibody for LRRK2/Dardarin

SMC-445D-A565 0.1mg
EUR 399
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with ATTO 565.

Monoclonal antibody for LRRK2/Dardarin

SMC-445D-A594 0.1mg
EUR 399
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with ATTO 594.

Monoclonal antibody for LRRK2/Dardarin

SMC-445D-A633 0.1mg
EUR 399
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with ATTO 633.

Monoclonal antibody for LRRK2/Dardarin

SMC-445D-A655 0.1mg
EUR 399
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with ATTO 655.

Monoclonal antibody for LRRK2/Dardarin

SMC-445D-A680 0.1mg
EUR 399
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with ATTO 680.

Monoclonal antibody for LRRK2/Dardarin

SMC-445D-A700 0.1mg
EUR 399
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with ATTO 700.

Monoclonal antibody for LRRK2/Dardarin

SMC-445D-ALP 0.1mg
EUR 393
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with Alkaline Phosphatase.

Monoclonal antibody for LRRK2/Dardarin

SMC-445D-APC 0.1mg
EUR 398
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with APC.

Monoclonal antibody for LRRK2/Dardarin

SMC-445D-APCCY7 0.1mg
EUR 470
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with APC/Cy7.

Monoclonal antibody for LRRK2/Dardarin

SMC-445D-BI 0.1mg
EUR 395
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with Biotin.

Monoclonal antibody for LRRK2/Dardarin

SMC-445D-DY350 0.1mg
EUR 413
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with Dylight 350.

Monoclonal antibody for LRRK2/Dardarin

SMC-445D-DY405 0.1mg
EUR 402
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with Dylight 405.

Monoclonal antibody for LRRK2/Dardarin

SMC-445D-DY488 0.1mg
EUR 392
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with Dylight 488.

Monoclonal antibody for LRRK2/Dardarin

SMC-445D-DY594 0.1mg
EUR 394
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with Dylight 594.

Monoclonal antibody for LRRK2/Dardarin

SMC-445D-DY633 0.1mg
EUR 389
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with Dylight 633.

Monoclonal antibody for LRRK2/Dardarin

SMC-445D-FITC 0.1mg
EUR 391
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with FITC.

Monoclonal antibody for LRRK2/Dardarin

SMC-445D-HRP 0.1mg
EUR 387
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with HRP.

Monoclonal antibody for LRRK2/Dardarin

SMC-445D-P594 0.1mg
EUR 406
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with PE/ATTO 594.

Monoclonal antibody for LRRK2/Dardarin

SMC-445D-PCP 0.1mg
EUR 398
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with PerCP.

Monoclonal antibody for LRRK2/Dardarin

SMC-445D-RPE 0.1mg
EUR 396
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with RPE.

Monoclonal antibody for LRRK2/Dardarin

SMC-445D-STR 0.1mg
EUR 397
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with Streptavidin.

Monoclonal antibody for LRRK2/Dardarin

SMC-445S 0.012mg
EUR 65
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S231B-34 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1. . The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is not conjugated.

Monoclonal antibody for LRRK2/Dardarin

SMC-446D 0.1mg
EUR 353
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is not conjugated.

Monoclonal antibody for LRRK2/Dardarin

SMC-446D-A390 0.1mg
EUR 400
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with ATTO 390.

Monoclonal antibody for LRRK2/Dardarin

SMC-446D-A488 0.1mg
EUR 399
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with ATTO 488.

Monoclonal antibody for LRRK2/Dardarin

SMC-446D-A565 0.1mg
EUR 399
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with ATTO 565.

Monoclonal antibody for LRRK2/Dardarin

SMC-446D-A594 0.1mg
EUR 399
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with ATTO 594.

Monoclonal antibody for LRRK2/Dardarin

SMC-446D-A633 0.1mg
EUR 399
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with ATTO 633.

Monoclonal antibody for LRRK2/Dardarin

SMC-446D-A655 0.1mg
EUR 399
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with ATTO 655.

Monoclonal antibody for LRRK2/Dardarin

SMC-446D-A680 0.1mg
EUR 399
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with ATTO 680.

Monoclonal antibody for LRRK2/Dardarin

SMC-446D-A700 0.1mg
EUR 399
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with ATTO 700.

Monoclonal antibody for LRRK2/Dardarin

SMC-446D-ALP 0.1mg
EUR 393
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with Alkaline Phosphatase.

Monoclonal antibody for LRRK2/Dardarin

SMC-446D-APC 0.1mg
EUR 398
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with APC.

Monoclonal antibody for LRRK2/Dardarin

SMC-446D-APCCY7 0.1mg
EUR 470
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with APC/Cy7.

Monoclonal antibody for LRRK2/Dardarin

SMC-446D-BI 0.1mg
EUR 395
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with Biotin.

Monoclonal antibody for LRRK2/Dardarin

SMC-446D-DY350 0.1mg
EUR 413
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with Dylight 350.

Monoclonal antibody for LRRK2/Dardarin

SMC-446D-DY405 0.1mg
EUR 402
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with Dylight 405.

Monoclonal antibody for LRRK2/Dardarin

SMC-446D-DY488 0.1mg
EUR 392
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with Dylight 488.

Monoclonal antibody for LRRK2/Dardarin

SMC-446D-DY594 0.1mg
EUR 394
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with Dylight 594.

Monoclonal antibody for LRRK2/Dardarin

SMC-446D-DY633 0.1mg
EUR 389
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with Dylight 633.

Monoclonal antibody for LRRK2/Dardarin

SMC-446D-FITC 0.1mg
EUR 391
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with FITC.

Monoclonal antibody for LRRK2/Dardarin

SMC-446D-HRP 0.1mg
EUR 387
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with HRP.

Monoclonal antibody for LRRK2/Dardarin

SMC-446D-P594 0.1mg
EUR 406
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with PE/ATTO 594.

Monoclonal antibody for LRRK2/Dardarin

SMC-446D-PCP 0.1mg
EUR 398
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S138-6 against Human | Mouse | Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with PerCP.

Monoclonal antibody for LRRK2/Dardarin

SMC-446D-RPE 0.1mg
EUR 396
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S138-6 against Human | Mouse | Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with RPE.

Monoclonal antibody for LRRK2/Dardarin

SMC-446D-STR 0.1mg
EUR 397
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S138-6 against Human | Mouse | Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with Streptavidin.

Monoclonal antibody for LRRK2/Dardarin

SMC-446S 0.012mg
EUR 65
  • LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
  • Show more
Description: A monoclonal antibody from clone S138-6 against Human | Mouse | Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is not conjugated.

LRRK2 Blocking Peptide

DF2668-BP 1mg
EUR 195

LRRK2 cloning plasmid

CSB-CL722493HU-10ug 10ug
EUR 2770
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 7584
  • Sequence: atggctagtggcagctgtcaggggtgcgaagaggacgaggaaactctgaagaagttgatagtcaggctgaacaatgtccaggaaggaaaacagatagaaacgctggtccaaatcctggaggatctgctggtgttcacgtactccgagcacgcctccaagttatttcaaggcaaaa
  • Show more
Description: A cloning plasmid for the LRRK2 gene.

LRRK2-IN-1

A3558-10 10 mg
EUR 148
Description: LRRK2-IN-1 is a potent and selective inhibitor of LRRK2 with IC50 value of 13 nM. [1]LRRK2 (Leucine-rich repeat kinase 2) is also known dardarin. LRRK2 belongs to the leucine-rich repeat kinase family.

LRRK2-IN-1

A3558-100 100 mg
EUR 595
Description: LRRK2-IN-1 is a potent and selective inhibitor of LRRK2 with IC50 value of 13 nM. [1]LRRK2 (Leucine-rich repeat kinase 2) is also known dardarin. LRRK2 belongs to the leucine-rich repeat kinase family.

LRRK2-IN-1

A3558-5.1 10 mM (in 1mL DMSO)
EUR 197
Description: LRRK2-IN-1 is a potent and selective inhibitor of LRRK2 with IC50 value of 13 nM. [1]LRRK2 (Leucine-rich repeat kinase 2) is also known dardarin. LRRK2 belongs to the leucine-rich repeat kinase family.

LRRK2-IN-1

A3558-50 50 mg
EUR 421
Description: LRRK2-IN-1 is a potent and selective inhibitor of LRRK2 with IC50 value of 13 nM. [1]LRRK2 (Leucine-rich repeat kinase 2) is also known dardarin. LRRK2 belongs to the leucine-rich repeat kinase family.

LRRK2-IN-1

HY-10875 100mg
EUR 1083

LRRK2 inhibitor 1

HY-111493 50mg
EUR 2633

pDEST51- LRRK2- R1441G

PVT10304 2 ug
EUR 370

2XMyc-LRRK2-WT

PVT14586 2 ug
EUR 599

Anti-LRRK2 (3B2)

YF-MA11738 100 ug
EUR 363
Description: Mouse monoclonal to LRRK2

Polyclonal Goat Anti-LRRK2 / PARK8 (near C Terminus) Antibody

APR12148G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-LRRK2 / PARK8 (near C Terminus) . This antibody is tested and proven to work in the following applications:

Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Human)

4-PAH716Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRK2 (Phe1479~Pro1729)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Kinase 2 (LRRK2)

Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Human)

4-PAH716Hu02
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRK2 (Leu1966~Pro2147)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Kinase 2 (LRRK2)

Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Mouse)

4-PAH716Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRK2 (Leu761~Leu994)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Leucine Rich Repeat Kinase 2 (LRRK2)

Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Human), APC

4-PAH716Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRK2 (Phe1479~Pro1729)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with APC.

Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Human), Biotinylated

4-PAH716Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRK2 (Phe1479~Pro1729)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with Biotin.

Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Human), Cy3

4-PAH716Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRK2 (Phe1479~Pro1729)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with Cy3.

Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Human), FITC

4-PAH716Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRK2 (Phe1479~Pro1729)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with FITC.

Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Human), HRP

4-PAH716Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRK2 (Phe1479~Pro1729)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with HRP.

Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Human), PE

4-PAH716Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRK2 (Phe1479~Pro1729)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with PE.

Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Human), APC

4-PAH716Hu02-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRK2 (Leu1966~Pro2147)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with APC.

Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Human), Biotinylated

4-PAH716Hu02-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRK2 (Leu1966~Pro2147)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with Biotin.

Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Human), Cy3

4-PAH716Hu02-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRK2 (Leu1966~Pro2147)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with Cy3.

Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Human), FITC

4-PAH716Hu02-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRK2 (Leu1966~Pro2147)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with FITC.

Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Human), HRP

4-PAH716Hu02-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRK2 (Leu1966~Pro2147)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with HRP.

Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Human), PE

4-PAH716Hu02-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRK2 (Leu1966~Pro2147)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with PE.

Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Mouse), APC

4-PAH716Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRK2 (Leu761~Leu994)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with APC.

Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Mouse), Biotinylated

4-PAH716Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRK2 (Leu761~Leu994)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with Biotin.

Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Mouse), Cy3

4-PAH716Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRK2 (Leu761~Leu994)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with Cy3.

Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Mouse), FITC

4-PAH716Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRK2 (Leu761~Leu994)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with FITC.

Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Mouse), HRP

4-PAH716Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRK2 (Leu761~Leu994)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with HRP.

Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Mouse), PE

4-PAH716Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRK2 (Leu761~Leu994)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with PE.

Monoclonal PARK8 (LRRK2) Antibody, Clone: 133AT720

APR11281G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human PARK8 (LRRK2). The antibodies are raised in Mouse and are from clone 133AT720. This antibody is applicable in WB, E

Monoclonal PARK8 (LRRK2) Antibody, Clone: 133AT1218

APR14064G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human PARK8 (LRRK2). The antibodies are raised in Mouse and are from clone 133AT1218. This antibody is applicable in WB, E

Human LRRK2 ELISA Kit

ELA-E1515h 96 Tests
EUR 824

Human LRRK2 ELISA KIT

ELI-04999h 96 Tests
EUR 824

Mouse Lrrk2 ELISA KIT

ELI-05000m 96 Tests
EUR 865

LRRK2 ELISA KIT|Human

EF005915 96 Tests
EUR 689

Mouse LRRK2 shRNA Plasmid

20-abx975764
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human LRRK2 shRNA Plasmid

20-abx964652
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LRRK2 (Human) ELISA Kit

K4228-100
EUR 805

Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Human), APC-Cy7

4-PAH716Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRK2 (Phe1479~Pro1729)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with APC-Cy7.

Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Human), APC-Cy7

4-PAH716Hu02-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRK2 (Leu1966~Pro2147)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with APC-Cy7.

Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Mouse), APC-Cy7

4-PAH716Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: LRRK2 (Leu761~Leu994)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with APC-Cy7.

Leucine Rich Repeat Kinase 2 (LRRK2) Antibody

20-abx177336
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Leucine Rich Repeat Kinase 2 (LRRK2) Antibody

20-abx210538
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Leucine Rich Repeat Kinase 2 (LRRK2) Antibody

20-abx210539
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Leucine Rich Repeat Kinase 2 (LRRK2) Antibody

20-abx103031
  • EUR 314.00
  • EUR 133.00
  • EUR 815.00
  • EUR 425.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Leucine Rich Repeat Kinase 2 (LRRK2) Antibody

20-abx103032
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Leucine Rich Repeat Kinase 2 (LRRK2) Antibody

20-abx103033
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Leucine Rich Repeat Kinase 2 (LRRK2) Antibody

20-abx173338
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Leucine Rich Repeat Kinase 2 (LRRK2) Antibody

20-abx333873
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-LRRK2 / PARK8 (near C Terminus) antibody

STJ70619 100 µg
EUR 359

Genome edited iPSCs (KO) LRRK2-/-

ASE-9403 1 vial (1 x 10^6)
EUR 3087.5
Description: 12 month

Lrrk2 ORF Vector (Rat) (pORF)

ORF070048 1.0 ug DNA
EUR 2743

LRRK2 ORF Vector (Human) (pORF)

ORF023150 1.0 ug DNA
EUR 2744

Lrrk2 ORF Vector (Mouse) (pORF)

ORF049476 1.0 ug DNA
EUR 2744

CZC 54252 Hydrochloride (LRRK2 inhibitor)

SIH-439-25MG 25 mg
EUR 535
  • CZC 54252 Hydrochloride is a potent leucine-rich repeat kinase 2 (LRRK2) inhibitor.
Description: The substance CZC 54252 Hydrochloride is a lrrk2 inhibitor. It is synthetically produced and has a purity of >98%. The pure substance is yellow solid which is soluble to 100 mM in DMSO.

CZC 54252 Hydrochloride (LRRK2 inhibitor)

SIH-439-5MG 5 mg
EUR 182
  • CZC 54252 Hydrochloride is a potent leucine-rich repeat kinase 2 (LRRK2) inhibitor.
Description: The substance CZC 54252 Hydrochloride is a lrrk2 inhibitor. It is synthetically produced and has a purity of >98%. The pure substance is yellow solid which is soluble to 100 mM in DMSO.

LRRK2 ELISA Kit (Human) (OKAN06632)

OKAN06632 96 Wells
EUR 792
Description: Description of target: This gene is a member of the leucine-rich repeat kinase family and encodes a protein with an ankryin repeat region, a leucine-rich repeat (LRR) domain, a kinase domain, a DFG-like motif, a RAS domain, a GTPase domain, a MLK-like domain, and a WD40 domain. The protein is present largely in the cytoplasm but also associates with the mitochondrial outer membrane. Mutations in this gene have been associated with Parkinson disease-8.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 33 pg/mL

LRRK2 ELISA Kit (Mouse) (OKCA02403)

OKCA02403 96 Wells
EUR 846
Description: Description of target: Positively regulates autophagy through a calcium-dependent activation of the CaMKK/AMPK signaling pathway. The process involves activation of nicotinic acid adenine dinucleotide phosphate (NAADP) receptors, increase in lysosomal pH, and calcium release from lysosomes. Together with RAB29, plays a role in the retrograde trafficking pathway for recycling proteins, such as mannose 6 phosphate receptor (M6PR), between lysosomes and the Golgi apparatus in a retromer-dependent manner. Regulates neuronal process morphology in the intact central nervous system (CNS). Phosphorylates PRDX3. Has GTPase activity.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 8.59 pg/mL

LRRK2 ELISA Kit (Rat) (OKCD04241)

OKCD04241 96 Wells
EUR 936
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 29 pg/mL

LRRK2 ELISA Kit (Human) (OKCD09087)

OKCD09087 96 Wells
EUR 975
Description: Description of target: This gene is a member of the leucine-rich repeat kinase family and encodes a protein with an ankryin repeat region, a leucine-rich repeat (LRR) domain, a kinase domain, a DFG-like motif, a RAS domain, a GTPase domain, a MLK-like domain, and a WD40 domain. The protein is present largely in the cytoplasm but also associates with the mitochondrial outer membrane. Mutations in this gene have been associated with Parkinson disease-8.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 31pg/mL

LRRK2 ELISA Kit (Human) (OKEH04209)

OKEH04209 96 Wells
EUR 1014
Description: Description of target: This gene is a member of the leucine-rich repeat kinase family and encodes a protein with an ankryin repeat region, a leucine-rich repeat (LRR) domain, a kinase domain, a DFG-like motif, a RAS domain, a GTPase domain, a MLK-like domain, and a WD40 domain. The protein is present largely in the cytoplasm but also associates with the mitochondrial outer membrane. Mutations in this gene have been associated with Parkinson disease-8.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

LRRK2 ELISA Kit (Mouse) (OKEH05425)

OKEH05425 96 Wells
EUR 662
Description: Description of target: Positively regulates autophagy through a calcium-dependent activation of the CaMKK/AMPK signaling pathway. The process involves activation of nicotinic acid adenine dinucleotide phosphate (NAADP) receptors, increase in lysosomal pH, and calcium release from lysosomes. Together with RAB29, plays a role in the retrograde trafficking pathway for recycling proteins, such as mannose 6 phosphate receptor (M6PR), between lysosomes and the Golgi apparatus in a retromer-dependent manner. Regulates neuronal process morphology in the intact central nervous system (CNS). Phosphorylates PRDX3. Has GTPase activity.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.082 ng/mL

Leucine Rich Repeat Kinase 2 (LRRK2) Antibody (Biotin)

20-abx272413
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Leucine Rich Repeat Kinase 2 (LRRK2) Antibody (HRP)

20-abx336339
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Leucine Rich Repeat Kinase 2 (LRRK2) Antibody (FITC)

20-abx336340
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Leucine Rich Repeat Kinase 2 (LRRK2) Antibody (Biotin)

20-abx336341
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Lrrk2 sgRNA CRISPR Lentivector set (Rat)

K6220201 3 x 1.0 ug
EUR 339

Lrrk2 sgRNA CRISPR Lentivector set (Mouse)

K4401201 3 x 1.0 ug
EUR 339

LRRK2 sgRNA CRISPR Lentivector set (Human)

K1238901 3 x 1.0 ug
EUR 339

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

LRRK2 Rabbit Polyclonal Antibody