LRRK2 Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
LRRK2 Polyclonal Antibody |
ABP59149-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human LRRK2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of LRRK2 from Human, Mouse. This LRRK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LRRK2 protein |
LRRK2 Polyclonal Antibody |
ABP59149-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human LRRK2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of LRRK2 from Human, Mouse. This LRRK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LRRK2 protein |
LRRK2 Polyclonal Antibody |
ES10815-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against LRRK2 from Human/Mouse. This antibody is tested and validated for IHC |
LRRK2 Polyclonal Antibody |
ES10815-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against LRRK2 from Human/Mouse. This antibody is tested and validated for IHC |
LRRK2 Rabbit pAb |
A0859-100ul |
Abclonal |
100 ul |
EUR 308 |
LRRK2 Rabbit pAb |
A0859-200ul |
Abclonal |
200 ul |
EUR 459 |
LRRK2 Rabbit pAb |
A0859-20ul |
Abclonal |
20 ul |
EUR 183 |
LRRK2 Rabbit pAb |
A0859-50ul |
Abclonal |
50 ul |
EUR 223 |
LRRK2 Rabbit pAb |
A10959-100ul |
Abclonal |
100 ul |
EUR 308 |
LRRK2 Rabbit pAb |
A10959-200ul |
Abclonal |
200 ul |
EUR 459 |
LRRK2 Rabbit pAb |
A10959-20ul |
Abclonal |
20 ul |
Ask for price |
LRRK2 Rabbit pAb |
A10959-50ul |
Abclonal |
50 ul |
Ask for price |
LRRK2 Rabbit pAb |
A17253-100ul |
Abclonal |
100 ul |
EUR 308 |
LRRK2 Rabbit pAb |
A17253-200ul |
Abclonal |
200 ul |
EUR 459 |
LRRK2 Rabbit pAb |
A17253-20ul |
Abclonal |
20 ul |
EUR 183 |
LRRK2 Rabbit pAb |
A17253-50ul |
Abclonal |
50 ul |
EUR 223 |
Human Leucine Rich Repeat Kinase 2 (LRRK2) ELISA Kit |
DLR-LRRK2-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Leucine Rich Repeat Kinase 2 (LRRK2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Leucine Rich Repeat Kinase 2 (LRRK2) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Leucine Rich Repeat Kinase 2 (LRRK2) ELISA Kit |
DLR-LRRK2-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Leucine Rich Repeat Kinase 2 (LRRK2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Leucine Rich Repeat Kinase 2 (LRRK2) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Leucine Rich Repeat Kinase 2 (LRRK2) ELISA Kit |
RDR-LRRK2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Leucine Rich Repeat Kinase 2 (LRRK2) ELISA Kit |
RDR-LRRK2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Leucine Rich Repeat Kinase 2 (LRRK2) ELISA Kit |
RD-LRRK2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Leucine Rich Repeat Kinase 2 (LRRK2) ELISA Kit |
RD-LRRK2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Anti-LRRK2 Rabbit Monoclonal Antibody |
M00221 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal LRRK2 Antibody. Validated in IP, IF, IHC, ICC, WB and tested in Human, Mouse, Rat. |
Anti-LRRK2 Rabbit Monoclonal Antibody |
M00221-1 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal LRRK2 Antibody. Validated in IF, WB and tested in Human, Mouse. |
Anti-LRRK2 Rabbit Monoclonal Antibody |
M00221-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal LRRK2 Antibody. Validated in IP, IF, IHC, WB and tested in Human, Mouse, Rat. |
Polyclonal PARK8 (LRRK2) Antibody (L955) |
APG03034G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PARK8 (LRRK2) (L955). This antibody is tested and proven to work in the following applications: |
Polyclonal PARK8 (LRRK2) Antibody (E519) |
APR11282G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PARK8 (LRRK2) (E519). This antibody is tested and proven to work in the following applications: |
Polyclonal PARK8 (LRRK2) Antibody (L893) |
APR11283G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PARK8 (LRRK2) (L893). This antibody is tested and proven to work in the following applications: |
Polyclonal PARK8 (LRRK2) Antibody (L899) |
APR11284G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PARK8 (LRRK2) (L899). This antibody is tested and proven to work in the following applications: |
Polyclonal LRRK2 Antibody (C-Terminus) |
APR12471G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human LRRK2 (C-Terminus). This antibody is tested and proven to work in the following applications: |
LRRK2 Antibody |
35803-100ul |
SAB |
100ul |
EUR 252 |
LRRK2 Antibody |
1-CSB-PA902150 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against LRRK2. Recognizes LRRK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
LRRK2 Antibody |
1-CSB-PA722493LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LRRK2. Recognizes LRRK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
LRRK2 Antibody |
DF2668 |
Affbiotech |
200ul |
EUR 304 |
Description: LRRK2 antibody detects endogenous levels of total LRRK2. |
LRRK2 Antibody |
1-CSB-PA444926 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against LRRK2. Recognizes LRRK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
LRRK2 Conjugated Antibody |
C35803 |
SAB |
100ul |
EUR 397 |
Anti-LRRK2 Antibody |
PB9281 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-LRRK2 antibody |
STJ112849 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the leucine-rich repeat kinase family and encodes a protein with an ankryin repeat region, a leucine-rich repeat (LRR) domain, a kinase domain, a DFG-like motif, a RAS domain, a GTPase domain, a MLK-like domain, and a WD40 domain. The protein is present largely in the cytoplasm but also associates with the mitochondrial outer membrane. Mutations in this gene have been associated with Parkinson disease-8. |
Anti-LRRK2 antibody |
STJ191973 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to LRRK2 |
Anti-Phospho-LRRK2 (S935) Rabbit Monoclonal Antibody |
P00221 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal Phospho-LRRK2 (S935) Antibody. Validated in IF, WB and tested in Human, Mouse. |
anti-LRRK2 |
YF-PA26847 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to LRRK2 |
LRRK2 Antibody, HRP conjugated |
1-CSB-PA722493LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LRRK2. Recognizes LRRK2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
LRRK2 Antibody, FITC conjugated |
1-CSB-PA722493LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LRRK2. Recognizes LRRK2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
LRRK2 Antibody, Biotin conjugated |
1-CSB-PA722493LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LRRK2. Recognizes LRRK2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Monoclonal antibody for LRRK2/Dardarin |
SMC-445D |
Stressmarq |
0.1mg |
EUR 353 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1.
. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is not conjugated. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-445D-A390 |
Stressmarq |
0.1mg |
EUR 400 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1.
. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with ATTO 390. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-445D-A488 |
Stressmarq |
0.1mg |
EUR 399 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1.
. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with ATTO 488. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-445D-A565 |
Stressmarq |
0.1mg |
EUR 399 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1.
. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with ATTO 565. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-445D-A594 |
Stressmarq |
0.1mg |
EUR 399 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1.
. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with ATTO 594. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-445D-A633 |
Stressmarq |
0.1mg |
EUR 399 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1.
. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with ATTO 633. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-445D-A655 |
Stressmarq |
0.1mg |
EUR 399 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1.
. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with ATTO 655. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-445D-A680 |
Stressmarq |
0.1mg |
EUR 399 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1.
. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with ATTO 680. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-445D-A700 |
Stressmarq |
0.1mg |
EUR 399 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1.
. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with ATTO 700. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-445D-ALP |
Stressmarq |
0.1mg |
EUR 393 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1.
. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with Alkaline Phosphatase. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-445D-APC |
Stressmarq |
0.1mg |
EUR 398 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1.
. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with APC. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-445D-APCCY7 |
Stressmarq |
0.1mg |
EUR 470 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1.
. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with APC/Cy7. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-445D-BI |
Stressmarq |
0.1mg |
EUR 395 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1.
. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with Biotin. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-445D-DY350 |
Stressmarq |
0.1mg |
EUR 413 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1.
. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with Dylight 350. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-445D-DY405 |
Stressmarq |
0.1mg |
EUR 402 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1.
. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with Dylight 405. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-445D-DY488 |
Stressmarq |
0.1mg |
EUR 392 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1.
. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with Dylight 488. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-445D-DY594 |
Stressmarq |
0.1mg |
EUR 394 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1.
. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with Dylight 594. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-445D-DY633 |
Stressmarq |
0.1mg |
EUR 389 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1.
. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with Dylight 633. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-445D-FITC |
Stressmarq |
0.1mg |
EUR 391 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1.
. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with FITC. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-445D-HRP |
Stressmarq |
0.1mg |
EUR 387 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1.
. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with HRP. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-445D-P594 |
Stressmarq |
0.1mg |
EUR 406 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S231B-34 against Human LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1.
. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with PE/ATTO 594. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-445D-PCP |
Stressmarq |
0.1mg |
EUR 398 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S231B-34 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1.
. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with PerCP. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-445D-RPE |
Stressmarq |
0.1mg |
EUR 396 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S231B-34 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1.
. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with RPE. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-445D-STR |
Stressmarq |
0.1mg |
EUR 397 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S231B-34 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1.
. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is conjugated with Streptavidin. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-445S |
Stressmarq |
0.012mg |
EUR 65 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S231B-34 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein amino acids 841-960 of human LRRK2. 81% identical in mouse, 80% identical in rat. <30% identity with LRRK1.
. The antibody is tested and validated for WB, IHC, ICC/IF assays with the following recommended dilutions: WB (1:100). This MAb for LRRK2/Dardarin is not conjugated. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-446D |
Stressmarq |
0.1mg |
EUR 353 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is not conjugated. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-446D-A390 |
Stressmarq |
0.1mg |
EUR 400 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with ATTO 390. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-446D-A488 |
Stressmarq |
0.1mg |
EUR 399 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with ATTO 488. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-446D-A565 |
Stressmarq |
0.1mg |
EUR 399 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with ATTO 565. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-446D-A594 |
Stressmarq |
0.1mg |
EUR 399 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with ATTO 594. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-446D-A633 |
Stressmarq |
0.1mg |
EUR 399 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with ATTO 633. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-446D-A655 |
Stressmarq |
0.1mg |
EUR 399 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with ATTO 655. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-446D-A680 |
Stressmarq |
0.1mg |
EUR 399 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with ATTO 680. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-446D-A700 |
Stressmarq |
0.1mg |
EUR 399 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with ATTO 700. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-446D-ALP |
Stressmarq |
0.1mg |
EUR 393 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with Alkaline Phosphatase. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-446D-APC |
Stressmarq |
0.1mg |
EUR 398 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with APC. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-446D-APCCY7 |
Stressmarq |
0.1mg |
EUR 470 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with APC/Cy7. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-446D-BI |
Stressmarq |
0.1mg |
EUR 395 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with Biotin. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-446D-DY350 |
Stressmarq |
0.1mg |
EUR 413 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with Dylight 350. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-446D-DY405 |
Stressmarq |
0.1mg |
EUR 402 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with Dylight 405. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-446D-DY488 |
Stressmarq |
0.1mg |
EUR 392 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with Dylight 488. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-446D-DY594 |
Stressmarq |
0.1mg |
EUR 394 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with Dylight 594. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-446D-DY633 |
Stressmarq |
0.1mg |
EUR 389 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with Dylight 633. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-446D-FITC |
Stressmarq |
0.1mg |
EUR 391 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with FITC. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-446D-HRP |
Stressmarq |
0.1mg |
EUR 387 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with HRP. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-446D-P594 |
Stressmarq |
0.1mg |
EUR 406 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S138-6 against Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with PE/ATTO 594. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-446D-PCP |
Stressmarq |
0.1mg |
EUR 398 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S138-6 against Human | Mouse | Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with PerCP. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-446D-RPE |
Stressmarq |
0.1mg |
EUR 396 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S138-6 against Human | Mouse | Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with RPE. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-446D-STR |
Stressmarq |
0.1mg |
EUR 397 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S138-6 against Human | Mouse | Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is conjugated with Streptavidin. |
Monoclonal antibody for LRRK2/Dardarin |
SMC-446S |
Stressmarq |
0.012mg |
EUR 65 |
- LRRK2 is a large protein with multiple domains including several ankyrin, leucine-rich, and WD40 repeats, a Ras-like small GTPase family domain named Roc, and a kinase domain that is closely related to the RIP kinase domain. LRRK2 gene is expressed i
- Show more
|
Description: A monoclonal antibody from clone S138-6 against Human | Mouse | Rat LRRK2/Dardarin. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Fusion protein, amino acids 1-500 (N-terminus) of human LRRK2. 83% identical in mouse and rat. No significant identity with LRRK1.. The antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000). This MAb for LRRK2/Dardarin is not conjugated. |
LRRK2 Blocking Peptide |
DF2668-BP |
Affbiotech |
1mg |
EUR 195 |
LRRK2 cloning plasmid |
CSB-CL722493HU-10ug |
Cusabio |
10ug |
EUR 2770 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 7584
- Sequence: atggctagtggcagctgtcaggggtgcgaagaggacgaggaaactctgaagaagttgatagtcaggctgaacaatgtccaggaaggaaaacagatagaaacgctggtccaaatcctggaggatctgctggtgttcacgtactccgagcacgcctccaagttatttcaaggcaaaa
- Show more
|
Description: A cloning plasmid for the LRRK2 gene. |
LRRK2-IN-1 |
A3558-10 |
ApexBio |
10 mg |
EUR 148 |
Description: LRRK2-IN-1 is a potent and selective inhibitor of LRRK2 with IC50 value of 13 nM. [1]LRRK2 (Leucine-rich repeat kinase 2) is also known dardarin. LRRK2 belongs to the leucine-rich repeat kinase family. |
LRRK2-IN-1 |
A3558-100 |
ApexBio |
100 mg |
EUR 595 |
Description: LRRK2-IN-1 is a potent and selective inhibitor of LRRK2 with IC50 value of 13 nM. [1]LRRK2 (Leucine-rich repeat kinase 2) is also known dardarin. LRRK2 belongs to the leucine-rich repeat kinase family. |
LRRK2-IN-1 |
A3558-5.1 |
ApexBio |
10 mM (in 1mL DMSO) |
EUR 197 |
Description: LRRK2-IN-1 is a potent and selective inhibitor of LRRK2 with IC50 value of 13 nM. [1]LRRK2 (Leucine-rich repeat kinase 2) is also known dardarin. LRRK2 belongs to the leucine-rich repeat kinase family. |
LRRK2-IN-1 |
A3558-50 |
ApexBio |
50 mg |
EUR 421 |
Description: LRRK2-IN-1 is a potent and selective inhibitor of LRRK2 with IC50 value of 13 nM. [1]LRRK2 (Leucine-rich repeat kinase 2) is also known dardarin. LRRK2 belongs to the leucine-rich repeat kinase family. |
Anti-LRRK2 (3B2) |
YF-MA11738 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to LRRK2 |
Polyclonal Goat Anti-LRRK2 / PARK8 (near C Terminus) Antibody |
APR12148G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-LRRK2 / PARK8 (near C Terminus) . This antibody is tested and proven to work in the following applications: |
Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Human) |
4-PAH716Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LRRK2 (Phe1479~Pro1729)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Kinase 2 (LRRK2) |
Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Human) |
4-PAH716Hu02 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LRRK2 (Leu1966~Pro2147)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Kinase 2 (LRRK2) |
Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Mouse) |
4-PAH716Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LRRK2 (Leu761~Leu994)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Leucine Rich Repeat Kinase 2 (LRRK2) |
Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Human), APC |
4-PAH716Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LRRK2 (Phe1479~Pro1729)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with APC. |
Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Human), Biotinylated |
4-PAH716Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LRRK2 (Phe1479~Pro1729)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with Biotin. |
Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Human), Cy3 |
4-PAH716Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LRRK2 (Phe1479~Pro1729)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with Cy3. |
Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Human), FITC |
4-PAH716Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LRRK2 (Phe1479~Pro1729)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with FITC. |
Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Human), HRP |
4-PAH716Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LRRK2 (Phe1479~Pro1729)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with HRP. |
Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Human), PE |
4-PAH716Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LRRK2 (Phe1479~Pro1729)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with PE. |
Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Human), APC |
4-PAH716Hu02-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LRRK2 (Leu1966~Pro2147)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with APC. |
Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Human), Biotinylated |
4-PAH716Hu02-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LRRK2 (Leu1966~Pro2147)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with Biotin. |
Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Human), Cy3 |
4-PAH716Hu02-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LRRK2 (Leu1966~Pro2147)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with Cy3. |
Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Human), FITC |
4-PAH716Hu02-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LRRK2 (Leu1966~Pro2147)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with FITC. |
Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Human), HRP |
4-PAH716Hu02-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LRRK2 (Leu1966~Pro2147)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with HRP. |
Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Human), PE |
4-PAH716Hu02-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LRRK2 (Leu1966~Pro2147)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with PE. |
Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Mouse), APC |
4-PAH716Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LRRK2 (Leu761~Leu994)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with APC. |
Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Mouse), Biotinylated |
4-PAH716Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LRRK2 (Leu761~Leu994)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with Biotin. |
Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Mouse), Cy3 |
4-PAH716Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LRRK2 (Leu761~Leu994)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with Cy3. |
Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Mouse), FITC |
4-PAH716Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LRRK2 (Leu761~Leu994)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with FITC. |
Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Mouse), HRP |
4-PAH716Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LRRK2 (Leu761~Leu994)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with HRP. |
Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Mouse), PE |
4-PAH716Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LRRK2 (Leu761~Leu994)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with PE. |
Monoclonal PARK8 (LRRK2) Antibody, Clone: 133AT720 |
APR11281G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A Monoclonal antibody against Human PARK8 (LRRK2). The antibodies are raised in Mouse and are from clone 133AT720. This antibody is applicable in WB, E |
Monoclonal PARK8 (LRRK2) Antibody, Clone: 133AT1218 |
APR14064G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human PARK8 (LRRK2). The antibodies are raised in Mouse and are from clone 133AT1218. This antibody is applicable in WB, E |
Mouse LRRK2 shRNA Plasmid |
20-abx975764 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human LRRK2 shRNA Plasmid |
20-abx964652 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
LRRK2 (Human) ELISA Kit |
K4228-100 |
Biovision |
|
EUR 805 |
Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Human), APC-Cy7 |
4-PAH716Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LRRK2 (Phe1479~Pro1729)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with APC-Cy7. |
Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Human), APC-Cy7 |
4-PAH716Hu02-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LRRK2 (Leu1966~Pro2147)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with APC-Cy7. |
Leucine Rich Repeat Kinase 2 (LRRK2) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAH716Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: LRRK2 (Leu761~Leu994)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Leucine Rich Repeat Kinase 2 (LRRK2). This antibody is labeled with APC-Cy7. |
Leucine Rich Repeat Kinase 2 (LRRK2) Antibody |
20-abx177336 |
Abbexa |
|
|
|
Leucine Rich Repeat Kinase 2 (LRRK2) Antibody |
20-abx210538 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Leucine Rich Repeat Kinase 2 (LRRK2) Antibody |
20-abx210539 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Leucine Rich Repeat Kinase 2 (LRRK2) Antibody |
20-abx103031 |
Abbexa |
-
EUR 314.00
-
EUR 133.00
-
EUR 815.00
-
EUR 425.00
-
EUR 272.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Leucine Rich Repeat Kinase 2 (LRRK2) Antibody |
20-abx103032 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Leucine Rich Repeat Kinase 2 (LRRK2) Antibody |
20-abx103033 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Leucine Rich Repeat Kinase 2 (LRRK2) Antibody |
20-abx173338 |
Abbexa |
|
|
|
Leucine Rich Repeat Kinase 2 (LRRK2) Antibody |
20-abx333873 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Genome edited iPSCs (KO)Â LRRK2-/- |
ASE-9403 |
Applied StemCell |
1 vial (1 x 10^6) |
EUR 3087.5 |
Description: 12 month |
Lrrk2 ORF Vector (Rat) (pORF) |
ORF070048 |
ABM |
1.0 ug DNA |
EUR 2743 |
LRRK2 ORF Vector (Human) (pORF) |
ORF023150 |
ABM |
1.0 ug DNA |
EUR 2744 |
Lrrk2 ORF Vector (Mouse) (pORF) |
ORF049476 |
ABM |
1.0 ug DNA |
EUR 2744 |
CZC 54252 Hydrochloride (LRRK2 inhibitor) |
SIH-439-25MG |
Stressmarq |
25 mg |
EUR 535 |
- CZC 54252 Hydrochloride is a potent leucine-rich repeat kinase 2 (LRRK2) inhibitor.
|
Description: The substance CZC 54252 Hydrochloride is a lrrk2 inhibitor. It is synthetically produced and has a purity of >98%. The pure substance is yellow solid which is soluble to 100 mM in DMSO. |
CZC 54252 Hydrochloride (LRRK2 inhibitor) |
SIH-439-5MG |
Stressmarq |
5 mg |
EUR 182 |
- CZC 54252 Hydrochloride is a potent leucine-rich repeat kinase 2 (LRRK2) inhibitor.
|
Description: The substance CZC 54252 Hydrochloride is a lrrk2 inhibitor. It is synthetically produced and has a purity of >98%. The pure substance is yellow solid which is soluble to 100 mM in DMSO. |
LRRK2 ELISA Kit (Human) (OKAN06632) |
OKAN06632 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene is a member of the leucine-rich repeat kinase family and encodes a protein with an ankryin repeat region, a leucine-rich repeat (LRR) domain, a kinase domain, a DFG-like motif, a RAS domain, a GTPase domain, a MLK-like domain, and a WD40 domain. The protein is present largely in the cytoplasm but also associates with the mitochondrial outer membrane. Mutations in this gene have been associated with Parkinson disease-8.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 33 pg/mL |
LRRK2 ELISA Kit (Mouse) (OKCA02403) |
OKCA02403 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
Description: Description of target: Positively regulates autophagy through a calcium-dependent activation of the CaMKK/AMPK signaling pathway. The process involves activation of nicotinic acid adenine dinucleotide phosphate (NAADP) receptors, increase in lysosomal pH, and calcium release from lysosomes. Together with RAB29, plays a role in the retrograde trafficking pathway for recycling proteins, such as mannose 6 phosphate receptor (M6PR), between lysosomes and the Golgi apparatus in a retromer-dependent manner. Regulates neuronal process morphology in the intact central nervous system (CNS). Phosphorylates PRDX3. Has GTPase activity.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 8.59 pg/mL |
LRRK2 ELISA Kit (Rat) (OKCD04241) |
OKCD04241 |
Aviva Systems Biology |
96 Wells |
EUR 936 |
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 29 pg/mL |
LRRK2 ELISA Kit (Human) (OKCD09087) |
OKCD09087 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: This gene is a member of the leucine-rich repeat kinase family and encodes a protein with an ankryin repeat region, a leucine-rich repeat (LRR) domain, a kinase domain, a DFG-like motif, a RAS domain, a GTPase domain, a MLK-like domain, and a WD40 domain. The protein is present largely in the cytoplasm but also associates with the mitochondrial outer membrane. Mutations in this gene have been associated with Parkinson disease-8.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 31pg/mL |
LRRK2 ELISA Kit (Human) (OKEH04209) |
OKEH04209 |
Aviva Systems Biology |
96 Wells |
EUR 1014 |
Description: Description of target: This gene is a member of the leucine-rich repeat kinase family and encodes a protein with an ankryin repeat region, a leucine-rich repeat (LRR) domain, a kinase domain, a DFG-like motif, a RAS domain, a GTPase domain, a MLK-like domain, and a WD40 domain. The protein is present largely in the cytoplasm but also associates with the mitochondrial outer membrane. Mutations in this gene have been associated with Parkinson disease-8.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL |
LRRK2 ELISA Kit (Mouse) (OKEH05425) |
OKEH05425 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Positively regulates autophagy through a calcium-dependent activation of the CaMKK/AMPK signaling pathway. The process involves activation of nicotinic acid adenine dinucleotide phosphate (NAADP) receptors, increase in lysosomal pH, and calcium release from lysosomes. Together with RAB29, plays a role in the retrograde trafficking pathway for recycling proteins, such as mannose 6 phosphate receptor (M6PR), between lysosomes and the Golgi apparatus in a retromer-dependent manner. Regulates neuronal process morphology in the intact central nervous system (CNS). Phosphorylates PRDX3. Has GTPase activity.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.082 ng/mL |
Leucine Rich Repeat Kinase 2 (LRRK2) Antibody (Biotin) |
20-abx272413 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Leucine Rich Repeat Kinase 2 (LRRK2) Antibody (HRP) |
20-abx336339 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Leucine Rich Repeat Kinase 2 (LRRK2) Antibody (FITC) |
20-abx336340 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Leucine Rich Repeat Kinase 2 (LRRK2) Antibody (Biotin) |
20-abx336341 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Lrrk2 sgRNA CRISPR Lentivector set (Rat) |
K6220201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Lrrk2 sgRNA CRISPR Lentivector set (Mouse) |
K4401201 |
ABM |
3 x 1.0 ug |
EUR 339 |
LRRK2 sgRNA CRISPR Lentivector set (Human) |
K1238901 |
ABM |
3 x 1.0 ug |
EUR 339 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
LRRK2 Rabbit Polyclonal Antibody