UBE2O Rabbit Polyclonal Antibody
Order Now: info@isvee13.org
UBE2O Polyclonal Antibody |
A61634 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
UBE2O Polyclonal Antibody |
ABP60822-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human UBE2O protein
- Applications tips:
|
Description: A polyclonal antibody for detection of UBE2O from Human, Mouse. This UBE2O antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBE2O protein |
UBE2O Polyclonal Antibody |
ABP60822-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human UBE2O protein
- Applications tips:
|
Description: A polyclonal antibody for detection of UBE2O from Human, Mouse. This UBE2O antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBE2O protein |
UBE2O Polyclonal Antibody |
ABP60822-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human UBE2O protein
- Applications tips:
|
Description: A polyclonal antibody for detection of UBE2O from Human, Mouse. This UBE2O antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UBE2O protein |
UBE2O Polyclonal Antibody |
ES10440-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against UBE2O from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
UBE2O Polyclonal Antibody |
ES10440-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against UBE2O from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
UBE2O Rabbit pAb |
A17201-100ul |
Abclonal |
100 ul |
EUR 308 |
UBE2O Rabbit pAb |
A17201-200ul |
Abclonal |
200 ul |
EUR 459 |
UBE2O Rabbit pAb |
A17201-20ul |
Abclonal |
20 ul |
EUR 183 |
UBE2O Rabbit pAb |
A17201-50ul |
Abclonal |
50 ul |
EUR 223 |
UBE2O Polyclonal Conjugated Antibody |
C27266 |
SAB |
100ul |
EUR 397 |
UBE2O Polyclonal Conjugated Antibody |
C29994 |
SAB |
100ul |
EUR 397 |
UBE2O antibody |
70R-21111 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal UBE2O antibody |
UBE2O Antibody |
1-CSB-PA866339LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified |
Description: A polyclonal antibody against UBE2O. Recognizes UBE2O from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000 |
UBE2O antibody |
70R-3984 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal UBE2O antibody raised against the middle region of UBE2O |
UBE2O Antibody |
1-CSB-PA025473GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against UBE2O. Recognizes UBE2O from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
[KO Validated] UBE2O Polyclonal Antibody |
27266-100ul |
SAB |
100ul |
EUR 252 |
[KO Validated] UBE2O Polyclonal Antibody |
27266-50ul |
SAB |
50ul |
EUR 187 |
Polyclonal UBE2O antibody - middle region |
APR01365G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UBE2O - middle region. This antibody is tested and proven to work in the following applications: |
Polyclonal UBE2O Antibody (C-Terminus) |
APG01143G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human UBE2O (C-Terminus). This antibody is tested and proven to work in the following applications: |
UBE2O Polyclonal Antibody, Biotin Conjugated |
A61635 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
UBE2O Polyclonal Antibody, FITC Conjugated |
A61636 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
UBE2O Polyclonal Antibody, HRP Conjugated |
A61637 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
[KO Validated] UBE2O Rabbit pAb |
A10036-100ul |
Abclonal |
100 ul |
EUR 410 |
[KO Validated] UBE2O Rabbit pAb |
A10036-200ul |
Abclonal |
200 ul |
EUR 571 |
[KO Validated] UBE2O Rabbit pAb |
A10036-20ul |
Abclonal |
20 ul |
EUR 221 |
[KO Validated] UBE2O Rabbit pAb |
A10036-50ul |
Abclonal |
50 ul |
EUR 287 |
anti- UBE2O antibody |
FNab09181 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:200-1:2000
- Immunogen: ubiquitin-conjugating enzyme E2O
- Uniprot ID: Q9C0C9
- Gene ID: 63893
- Research Area: Epigenetics, Metabolism
|
Description: Antibody raised against UBE2O |
Anti-UBE2O antibody |
STJ191598 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to UBE2O |
UBE2O siRNA |
20-abx938799 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
UBE2O siRNA |
20-abx938800 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-UBE2O |
YF-PA20403 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to UBE2O |
Polyclonal E2-230K / UBE2O Antibody (C-Term) |
APG00392G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human E2-230K / UBE2O (C-Term). This antibody is tested and proven to work in the following applications: |
UBE2O Antibody, HRP conjugated |
1-CSB-PA866339LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified |
Description: A polyclonal antibody against UBE2O. Recognizes UBE2O from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
UBE2O Antibody, FITC conjugated |
1-CSB-PA866339LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified |
Description: A polyclonal antibody against UBE2O. Recognizes UBE2O from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
UBE2O Antibody, Biotin conjugated |
1-CSB-PA866339LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified |
Description: A polyclonal antibody against UBE2O. Recognizes UBE2O from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
UBE2O Blocking Peptide |
33R-10192 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UBE2O antibody, catalog no. 70R-3984 |
UBE2O cloning plasmid |
CSB-CL866339HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1401
- Sequence: atgactgtggagcagctgctgacgggctcgcccacctctccgactgtggagcctgagaagccaactcgggagaagaagtttctggatgacatcaagaagctacaggaaaacctcaagaagaccctggacaatgtggccattgtagaggaggagaagatggaagcagtgcccgacg
- Show more
|
Description: A cloning plasmid for the UBE2O gene. |
UBE2O cloning plasmid |
CSB-CL866339HU2-10ug |
Cusabio |
10ug |
EUR 733 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2226
- Sequence: atgacctcagccgacgtgatgtggcaggatggctccgtggaatgcaacatccgctccaacgacctcttccctgtgcaccacctggacaacaacgagttctgccctggagacttcgtggtagataagcgagtccagagctgtccagaccctgctgtctacggtgtggtacagtctg
- Show more
|
Description: A cloning plasmid for the UBE2O gene. |
Anti-UBE2O (2C10) |
YF-MA19174 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to UBE2O |
UBE2O Rabbit Polyclonal Antibody