UVRAG Rabbit Polyclonal Antibody – International Symposium on Veterinary Epidemiology and Economics

UVRAG Rabbit Polyclonal Antibody

Order Now: info@isvee13.org

UVRAG Polyclonal Antibody
ABP60866-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human UVRAG protein Applications tips:
Description: A polyclonal antibody for detection of UVRAG from Human. This UVRAG antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UVRAG protein

UVRAG Polyclonal Antibody
ABP60866-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human UVRAG protein Applications tips:
Description: A polyclonal antibody for detection of UVRAG from Human. This UVRAG antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UVRAG protein

UVRAG Polyclonal Antibody
ABP60866-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human UVRAG protein Applications tips:
Description: A polyclonal antibody for detection of UVRAG from Human. This UVRAG antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UVRAG protein

UVRAG Polyclonal Antibody
31556-100ul	SAB	100ul	EUR 252

UVRAG Polyclonal Antibody
31556-50ul	SAB	50ul	EUR 187

UVRAG Rabbit pAb
A8462-100ul	Abclonal	100 ul	EUR 308

UVRAG Rabbit pAb
A8462-200ul	Abclonal	200 ul	EUR 459

UVRAG Rabbit pAb
A8462-20ul	Abclonal	20 ul	EUR 183

UVRAG Rabbit pAb
A8462-50ul	Abclonal	50 ul	EUR 223

UVRAG Polyclonal Conjugated Antibody
C31556	SAB	100ul	EUR 397

UVRAG antibody
70R-21226	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal UVRAG antibody

UVRAG Antibody
1-CSB-PA882187HA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UVRAG. Recognizes UVRAG from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

UVRAG Antibody
1-CSB-PA025776GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20â„ƒ, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against UVRAG. Recognizes UVRAG from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

Polyclonal UVRAG Antibody (C-Terminus)
APR03194G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UVRAG (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal UVRAG Antibody (C-term L555)
APR04324G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UVRAG (C-term L555). This antibody is tested and proven to work in the following applications:

anti- UVRAG antibody
FNab09352	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:100 Immunogen: UV radiation resistance associated gene Uniprot ID: Q9P2Y5 Gene ID: 7405 Research Area: Cardiovascular, Metabolism
Description: Antibody raised against UVRAG

Anti-UVRAG antibody
PAab09352	Lifescience Market	100 ug	EUR 386

Anti-UVRAG antibody
STJ110760	St John's Laboratory	100 µl	EUR 277
Description: This gene complements the ultraviolet sensitivity of xeroderma pigmentosum group C cells and encodes a protein with a C2 domain. The protein activates the Beclin1-PI(3)KC3 complex, promoting autophagy and suppressing the proliferation and tumorigenicity of human colon cancer cells. Chromosomal aberrations involving this gene are associated with left-right axis malformation and mutations in this gene have been associated with colon cancer.

Anti-UVRAG antibody
STJ192029	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to UVRAG

UVRAG siRNA
20-abx939299	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-UVRAG
YF-PA15253	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to UVRAG

anti-UVRAG
YF-PA15254	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to UVRAG

UVRAG Antibody, HRP conjugated
1-CSB-PA882187HB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UVRAG. Recognizes UVRAG from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

UVRAG Antibody, FITC conjugated
1-CSB-PA882187HC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UVRAG. Recognizes UVRAG from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

UVRAG Antibody, Biotin conjugated
1-CSB-PA882187HD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UVRAG. Recognizes UVRAG from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Antibody for Human UVRAG
SPC-605D	Stressmarq	0.1mg	EUR 354
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is unconjugated.

Antibody for Human UVRAG
SPC-605D-A390	Stressmarq	0.1mg	EUR 401
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 390.

Antibody for Human UVRAG
SPC-605D-A488	Stressmarq	0.1mg	EUR 400
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 488.

Antibody for Human UVRAG
SPC-605D-A565	Stressmarq	0.1mg	EUR 400
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 565.

Antibody for Human UVRAG
SPC-605D-A594	Stressmarq	0.1mg	EUR 400
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 594.

Antibody for Human UVRAG
SPC-605D-A633	Stressmarq	0.1mg	EUR 400
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 633.

Antibody for Human UVRAG
SPC-605D-A655	Stressmarq	0.1mg	EUR 400
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 655.

Antibody for Human UVRAG
SPC-605D-A680	Stressmarq	0.1mg	EUR 400
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 680.

Antibody for Human UVRAG
SPC-605D-A700	Stressmarq	0.1mg	EUR 400
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 700.

Antibody for Human UVRAG
SPC-605D-ALP	Stressmarq	0.1mg	EUR 394
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Alkaline Phosphatase.

Antibody for Human UVRAG
SPC-605D-APC	Stressmarq	0.1mg	EUR 399
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to APC .

Antibody for Human UVRAG
SPC-605D-APCCY7	Stressmarq	0.1mg	EUR 471
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to APC/Cy7.

Antibody for Human UVRAG
SPC-605D-BI	Stressmarq	0.1mg	EUR 396
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Biotin.

Antibody for Human UVRAG
SPC-605D-DY350	Stressmarq	0.1mg	EUR 414
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 350.

Antibody for Human UVRAG
SPC-605D-DY405	Stressmarq	0.1mg	EUR 403
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 405.

Antibody for Human UVRAG
SPC-605D-DY488	Stressmarq	0.1mg	EUR 393
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 488.

Antibody for Human UVRAG
SPC-605D-DY594	Stressmarq	0.1mg	EUR 395
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 594.

Antibody for Human UVRAG
SPC-605D-DY633	Stressmarq	0.1mg	EUR 390
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 633.

Antibody for Human UVRAG
SPC-605D-FITC	Stressmarq	0.1mg	EUR 392
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to FITC.

Antibody for Human UVRAG
SPC-605D-HRP	Stressmarq	0.1mg	EUR 388
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to HRP.

Antibody for Human UVRAG
SPC-605D-P594	Stressmarq	0.1mg	EUR 407
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to PE/ATTO 594.

Antibody for Human UVRAG
SPC-605D-PCP	Stressmarq	0.1mg	EUR 399
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to PerCP.

Antibody for Human UVRAG
SPC-605D-RPE	Stressmarq	0.1mg	EUR 397
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to RPE .

Antibody for Human UVRAG
SPC-605D-STR	Stressmarq	0.1mg	EUR 398
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Streptavidin.

Antibody for Human UVRAG
SPC-605S	Stressmarq	0.012mg	EUR 65
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is unconjugated.

Antibody for Human UVRAG
SPC-606D	Stressmarq	0.1mg	EUR 354
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is unconjugated.

Antibody for Human UVRAG
SPC-606D-A390	Stressmarq	0.1mg	EUR 401
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 390.

Antibody for Human UVRAG
SPC-606D-A488	Stressmarq	0.1mg	EUR 400
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 488.

Antibody for Human UVRAG
SPC-606D-A565	Stressmarq	0.1mg	EUR 400
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 565.

Antibody for Human UVRAG
SPC-606D-A594	Stressmarq	0.1mg	EUR 400
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 594.

Antibody for Human UVRAG
SPC-606D-A633	Stressmarq	0.1mg	EUR 400
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 633.

Antibody for Human UVRAG
SPC-606D-A655	Stressmarq	0.1mg	EUR 400
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 655.

Antibody for Human UVRAG
SPC-606D-A680	Stressmarq	0.1mg	EUR 400
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 680.

Antibody for Human UVRAG
SPC-606D-A700	Stressmarq	0.1mg	EUR 400
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to ATTO 700.

Antibody for Human UVRAG
SPC-606D-ALP	Stressmarq	0.1mg	EUR 394
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Alkaline Phosphatase.

Antibody for Human UVRAG
SPC-606D-APC	Stressmarq	0.1mg	EUR 399
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to APC .

Antibody for Human UVRAG
SPC-606D-APCCY7	Stressmarq	0.1mg	EUR 471
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to APC/Cy7.

Antibody for Human UVRAG
SPC-606D-BI	Stressmarq	0.1mg	EUR 396
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Biotin.

Antibody for Human UVRAG
SPC-606D-DY350	Stressmarq	0.1mg	EUR 414
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 350.

Antibody for Human UVRAG
SPC-606D-DY405	Stressmarq	0.1mg	EUR 403
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 405.

Antibody for Human UVRAG
SPC-606D-DY488	Stressmarq	0.1mg	EUR 393
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 488.

Antibody for Human UVRAG
SPC-606D-DY594	Stressmarq	0.1mg	EUR 395
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 594.

Antibody for Human UVRAG
SPC-606D-DY633	Stressmarq	0.1mg	EUR 390
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Dylight 633.

Antibody for Human UVRAG
SPC-606D-FITC	Stressmarq	0.1mg	EUR 392
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to FITC.

Antibody for Human UVRAG
SPC-606D-HRP	Stressmarq	0.1mg	EUR 388
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to HRP.

Antibody for Human UVRAG
SPC-606D-P594	Stressmarq	0.1mg	EUR 407
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to PE/ATTO 594.

Antibody for Human UVRAG
SPC-606D-PCP	Stressmarq	0.1mg	EUR 399
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to PerCP.

Antibody for Human UVRAG
SPC-606D-RPE	Stressmarq	0.1mg	EUR 397
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to RPE .

Antibody for Human UVRAG
SPC-606D-STR	Stressmarq	0.1mg	EUR 398
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is conjugated to Streptavidin.

Antibody for Human UVRAG
SPC-606S	Stressmarq	0.012mg	EUR 65
UVRAG (UV radiation resistance-associated gene) is associated with the Beclin-1/PI3KC3 complex and promotes PI3KC3 enzymatic activity and autophagy, while suppressing proliferation (1). Beclin-1 binding to UVRAG promotes both autophagosome maturation Show more
Description: A polyclonal antibody for UVRAG from Human \| Mouse \| Rat. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of human UVRAG. The Antibody is tested and validated for WB, ICC/IF assays with the following recommended dilutions: WB (1:1000); ICC/IF (1:100). This UVRAG antibody is unconjugated.

UVRAG cloning plasmid
CSB-CL882187HU-10ug	Cusabio	10ug	EUR 698
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 2100 Sequence: atgagcgcctccgcgtcggtcgggggccaggtcccccagccacccccgggcccggccgctgctctgcctcccggttctgccgcgcgggccctgcatgtggagctgccgtctcagcagcggcgtcttcgacatcttcggaacattgctgcccggaacattgttaatagaaatggcc Show more
Description: A cloning plasmid for the UVRAG gene.

Anti-UVRAG (2E8)
YF-MA16038	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to UVRAG

UVRAG ELISA KIT\|Human
EF004158	Lifescience Market	96 Tests	EUR 689

Human UVRAG ELISA KIT
ELI-28505h	Lifescience Market	96 Tests	EUR 824

Human UVRAG shRNA Plasmid
20-abx955065	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

UVRAG Recombinant Protein (Human)
RP034189	ABM	100 ug	Ask for price

UVRAG Recombinant Protein (Rat)
RP236216	ABM	100 ug	Ask for price

UVRAG Recombinant Protein (Mouse)
RP183581	ABM	100 ug	Ask for price

pEGFP-C3-UVRAG Plasmid
PVTB00334-2a	Lifescience Market	2 ug	EUR 356

Uv Radiation Resistance Associated Gene (UVRAG) Antibody
20-abx116558	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Uvrag ORF Vector (Rat) (pORF)
ORF078740	ABM	1.0 ug DNA	EUR 506

UVRAG ORF Vector (Human) (pORF)
ORF011397	ABM	1.0 ug DNA	EUR 95

Uvrag ORF Vector (Mouse) (pORF)
ORF061195	ABM	1.0 ug DNA	EUR 506

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
20-abx006162	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
abx030355-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
abx030355-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
abx030356-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
abx030356-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
abx030357-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
abx030357-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
abx030358-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
abx030358-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
20-abx313923	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
abx448488-100ug	Abbexa	100 ug	EUR 523
Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
abx448489-100ug	Abbexa	100 ug	EUR 523
Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
abx239352-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

UVRAG sgRNA CRISPR Lentivector set (Human)
K2604001	ABM	3 x 1.0 ug	EUR 339

Uvrag sgRNA CRISPR Lentivector set (Mouse)
K4705601	ABM	3 x 1.0 ug	EUR 339

Uvrag sgRNA CRISPR Lentivector set (Rat)
K6716701	ABM	3 x 1.0 ug	EUR 339

p3*FLAG-Myc-CMV-UVRAG Plasmid
PVTB00364-2a	Lifescience Market	2 ug	EUR 356

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (HRP)
20-abx313924	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (FITC)
20-abx313925	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (Biotin)
20-abx313926	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ALP)
abx446398-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ALP)
abx446399-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (APC)
abx446400-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (APC)
abx446401-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (Biotin)
abx446402-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (Biotin)
abx446403-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (FITC)
abx446404-100ug	Abbexa	100 ug	EUR 565
Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (FITC)
abx446405-100ug	Abbexa	100 ug	EUR 565
Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (HRP)
abx446406-100ug	Abbexa	100 ug	EUR 565
Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (HRP)
abx446407-100ug	Abbexa	100 ug	EUR 565
Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (PerCP)
abx446410-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (PerCP)
abx446411-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (RPE)
abx446412-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (RPE)
abx446413-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (Streptavidin)
abx446414-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (Streptavidin)
abx446415-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

UVRAG sgRNA CRISPR Lentivector (Human) (Target 1)
K2604002	ABM	1.0 ug DNA	EUR 154

UVRAG sgRNA CRISPR Lentivector (Human) (Target 2)
K2604003	ABM	1.0 ug DNA	EUR 154

UVRAG sgRNA CRISPR Lentivector (Human) (Target 3)
K2604004	ABM	1.0 ug DNA	EUR 154

Uvrag sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4705602	ABM	1.0 ug DNA	EUR 154

Uvrag sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4705603	ABM	1.0 ug DNA	EUR 154

Uvrag sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4705604	ABM	1.0 ug DNA	EUR 154

Uvrag sgRNA CRISPR Lentivector (Rat) (Target 1)
K6716702	ABM	1.0 ug DNA	EUR 154

Uvrag sgRNA CRISPR Lentivector (Rat) (Target 2)
K6716703	ABM	1.0 ug DNA	EUR 154

Uvrag sgRNA CRISPR Lentivector (Rat) (Target 3)
K6716704	ABM	1.0 ug DNA	EUR 154

UVRAG Protein Vector (Human) (pPB-C-His)
PV045585	ABM	500 ng	EUR 329

UVRAG Protein Vector (Human) (pPB-N-His)
PV045586	ABM	500 ng	EUR 329

UVRAG Protein Vector (Human) (pPM-C-HA)
PV045587	ABM	500 ng	EUR 329

UVRAG Protein Vector (Human) (pPM-C-His)
PV045588	ABM	500 ng	EUR 329

UVRAG Protein Vector (Rat) (pPB-C-His)
PV314958	ABM	500 ng	EUR 603

UVRAG Protein Vector (Rat) (pPB-N-His)
PV314959	ABM	500 ng	EUR 603

UVRAG Protein Vector (Rat) (pPM-C-HA)
PV314960	ABM	500 ng	EUR 603

UVRAG Protein Vector (Rat) (pPM-C-His)
PV314961	ABM	500 ng	EUR 603

UVRAG Protein Vector (Mouse) (pPB-C-His)
PV244778	ABM	500 ng	EUR 1065

UVRAG Protein Vector (Mouse) (pPB-N-His)
PV244779	ABM	500 ng	EUR 1065

UVRAG Protein Vector (Mouse) (pPM-C-HA)
PV244780	ABM	500 ng	EUR 1065

UVRAG Protein Vector (Mouse) (pPM-C-His)
PV244781	ABM	500 ng	EUR 1065

Uvrag 3'UTR GFP Stable Cell Line
TU171711	ABM	1.0 ml	Ask for price

UVRAG 3'UTR GFP Stable Cell Line
TU078037	ABM	1.0 ml	EUR 2333

Uvrag 3'UTR Luciferase Stable Cell Line
TU121711	ABM	1.0 ml	Ask for price

UVRAG 3'UTR Luciferase Stable Cell Line
TU028037	ABM	1.0 ml	EUR 2333

Uvrag 3'UTR Luciferase Stable Cell Line
TU222982	ABM	1.0 ml	Ask for price

Uvrag 3'UTR GFP Stable Cell Line
TU272982	ABM	1.0 ml	Ask for price

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 390)
abx446382-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 390)
abx446383-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 488)
abx446384-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 488)
abx446385-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 565)
abx446386-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 565)
abx446387-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 594)
abx446388-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 594)
abx446389-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 633)
abx446390-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 633)
abx446391-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 655)
abx446392-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 655)
abx446393-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 680)
abx446394-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 680)
abx446395-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 700)
abx446396-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ATTO 700)
abx446397-100ug	Abbexa	100 ug	EUR 578
Shipped within 5-12 working days.

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8579-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8579-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody
ES8580-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody
ES8580-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody
ES8582-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody
ES8582-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody
ES8583-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody
ES8583-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody
ABP57458-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

UVRAG Rabbit Polyclonal Antibody